Forensic and Population Genetics

Talk aimed at 15 year olds with a basic understanding of inheritance.

Transcript

1. Forensic and Population Genetics Elias Hernandis – 2014 · POLICE LINE DO NOT CROSS · POLICE LIN CROSS · POLICE LINE DO NOT CROSS · PO OSS · POLICE LINE DO NOT CROSS · POLIC
2. • Forensic investigators analyse evidence and reference samples • Fingerprints, bullet casings, leftovers, biological remains… • A comparison of the results leads to a conclusion presented to the judge
3. DNA Analysis • Used as a last resource for victim identification, after other types of evidence (fingerprints, bone remains) have been analysed • Used in conjunction with anthropology and other evidence • Analysed biological remains: bone and teeth, hair, blood, semen, muscle tissue + other unusual remains
4. DNA Analysis • Evidence is carefully taken to a forensic laboratory • Analysis is conducted differently according to the type of biological remain • Relying only on DNA identification is not sufficient to convict a suspect for a judge
5. Types of DNA • Autosomal DNA • Mitochondrial DNA (inherited only from the mother) • DNA in sexual chromosomes – Y chromosome (inherited only from the father)
6. What are we looking for? • DNA: 3 Billion bp – mtDNA: 16569 bp • Not all DNA is analysed • Only some fragments of non-coding DNA: STRs SNPs and D-loop (mtDNA).
7. Why non-coding DNA? • Spanish legislation forbids analysing DNA containing information about a person’s possible illnesses or physical characteristics except for the Amelogenin gene • Three types of DNA according to its function: • Coding DNA: used for protein synthesis - about 20.000 genes • Regulating DNA: regulates (activates and deactivates) other genes • Non-coding (junk) DNA: we don’t know what does it do… yet
8. Why non-coding DNA? • DNA undergoes mutations • Harmful mutations in coding DNA may cause the death or the infertility of the individual • Harmful mutations are not passed on to new generations (mostly) so coding DNA is almost the same for everyone • Mutations happening in junk DNA do not (normally) harm the individual so they get passed on to the next generation • Lots of genetic variability in junk DNA → uniqueness – Yay!
9. What are these fragments? • SNPs – Single Nucleotide Polymorphisms: variations in one bp, used exceptionally • D-Loop: a varying fragment of mtDNA • STRs – Short Tandem Repeats: different alleles mean different numbers of repetitions
10. STR Demo Allele DNA Sequence 4 GTACGATTCATTCATTCATTCGATC 5 GTACGATTCATTCATTCATTCATTCGATC 6 GTACGATTCATTCATTCATTCATTCATTCGATC D8S1179
11. Creating a genetic profile D8S1179 D21S11 D7S820 CSF1PO 12 - 15 28 - 29 12 - 12 11 - 12 D3S1358 TH01 D13S317 D16S539 17 - 18 8 - 9 11 - 12 8 - 12 D2S1338 D19S433 vWA TPOX 23 - 24 12 - 15 14 - 16 8 - 11 D18S51 AMEL D5S818 FGA 14 - 18 XY 10 - 12 21 - 26
13. Evidence • In a stormy evening, Ms Poppy, Mr White and Mrs Violet attended a party at Mr Blue’s. • That night, a corpse was found in the library at Mr. Blue’s • The identity of the body cannot be known through fingerprints due to its bad condition, but we have a presumptive identity for the body.
14. Evidence • The family of the presumed victim is contacted, samples are taken from a spouse and a daughter • Profiles cannot be compared directly, a kinship study must be done – Yay! • Remember inheritance problems? • Co-dominance
15. AB AA AA AA AB AB Co-dominance
16. 12 - 13 13 - 14 12 - 13 12 - 14 13 - 13 13 - 14 Co-dominance + multiple allelism
17. Co-dominance + multiple allelism X - Y 20 - 21 20 - 24 21 - 24 20 - 27 21 - 27
18. Co-dominance + multiple allelism 24 - 27 20 - 21 20 - 24 21 - 24 20 - 27 21 - 27
19. Victim Spouse Daughter
20. Forensic Investigation • Once the identity of the victim is known, the investigation can begin • All the attendees to the party become suspects, thorough interrogation is performed • Autopsy results show the victim, now known as Mr Green, was stabbed • Stains of blood are found in Mr Green’s hair
21. Blood stain Mr Green Mr Blue Mrs Poppy Mr White
22. Forensic Investigation • Mr White seems to be guilty • Is there a possibility that another person has the same genetic profile as Mr White? Blood stain Mr White
23. Forensic Investigation • Actually, there is. Not all DNA is analysed so there is a chance that this can happen • DNA is not the only evidence • The probability of this happening can be calculated • Population genetics comes into play – Yay!
24. Population Genetics
25. Population Genetics • The probability of finding a blue-eyed person in sub-Saharan Africa is not the same as in Scandinavia • Geneticists study the frequency of each allele for each marker in the population of interest • These frequencies are slightly different for STRs in different areas, but widely vary for mtDNA and Y chromosome markers
26. Population Genetics Distribution of D8S1179 alleles Distribution of Penta-D alleles Data from USC
27. Population Genetics Distribution of blood groups – ABO system 0 A B AB US 44% 42% 10% 4% Spain 45% 42% 10% 3% Colombia 61% 29% 8% 2% Japan 30% 40% 20% 10% Data from Stanford University, Federación Nacional de Donantes de la Sangre, Frecuencia de grupos sanguíneos y factor Rh en donantes de sangre, Colombia ,1996; M. Beltrán et Al.
28. Propagation of mtDNA haplogroups
29. Population Genetics: case study • Not only mtDNA and Y-STRs allow us to trace migrations back hundreds of thousands of years, more recent migrations can also be traced • During the colonisation of America in the 15th century, male colonists had children with female natives • mtDNA was passed by mothers, but Y chromosomes by fathers • Children have a South American mtDNA with a European Y chromosome
30. Q & A