$30 off During Our Annual Pro Sale. View Details »

אבולוציה ומוטציה בעתות עקה

Yoav Ram
May 16, 2013

אבולוציה ומוטציה בעתות עקה

מוטציות הן חומר הגלם עליו פועלת הברירה הטבעית ליצירת התאמות חדשות. אחת האסטרטגיות העומדות בפני יצורים חיים הנמצאים במצוקה היא האצת הקצב בו מוטציות נוצרות ע"י שיתוק מנגנוני תיקון ה-DNA.

מנגנון זה, הנקרא "היפר-מוטציה מושרית עקה", נצפה בחיידקים, בשמרים ואף בתאים סרטניים. בהרצאה זו נדון בהסברים אבולוציוניים אפשריים לתופעה מעניינת זו.

Event page: https://pausa.tau.ac.il/events/evolution/16-5-13

Yoav Ram

May 16, 2013
Tweet

More Decks by Yoav Ram

Other Decks in Science

Transcript

  1. הקע תותעב היצטומו היצולובא
    באוי
    םר
    "
    ןגב היצולובא
    :"
    תרדס
    לע תואצרה
    ינטובה ןגב היצולובא
    16
    יאמ
    2013
    ,
    18:00

    View Slide

  2. תודות
    2
    ןוריב הילמע ןרק
    -
    הלגיצ
    תינויצולובא הירואיתל הדבעמה
    ד לש
    "
    ינדה ךליל ר
    ע םייחה יעדמל הטלוקפה
    "
    ג ש
    '
    גרו
    '
    זייו
    לש היגולוקאו תירלוקלומ היגולויבל הקלחמה
    םיחמצ
    תטיסרבינוא
    לת
    -
    ביבא

    View Slide

  3. הקיטמתמו היגולויב
    3
    xkcd.com/435

    View Slide

  4. תיבושיח היגולויב
    Computational Biology

    הקיטמתמ

    בשחמה יעדמ

    הנכות

    הקיטסיטטס

    Data

    םילדומ
    4
    " = (1 − )/
    +
    for i in range(N):
    p = p*(1-U)/(p*w)

    View Slide

  5. תויסולכוא לש הקיטנג
    Population Genetics
    תיטמתמ היצולובא
    ,
    תיטרואיתו תיבושיח

    תורבתסהה תרות

    םיקחשמה תרות

    תוימאניד תוכרעמ

    תויטסכוטס תוכרעמ

    בשחמ תויצלומיס

    הקיטסיטטס
    5
    xkcd.com/55

    View Slide

  6. תויסולכוא לש הקיטנג
    6
    ר
    .
    א
    .
    רשיפ
    1890-1962
    ,
    הילגנא
    הילרטסואו
    "
    זאמ רתויב לודגה גולויבה
    ןיווראד
    "

    ציר
    '
    סניקוד דר
    "
    תא רצי ודבל טעמכש ןואג
    עדמ לש תודוסיה
    תינרדומה הקיטסיטטסה
    "

    דלאה סרדנא
    טייר לוויס
    1889-1988
    ,
    הרא
    "
    ב
    לש העפשהה תא שיגדה
    לע םייארקא םיכילהת
    היצטפדאו היצולובא
    ג
    '
    .
    ב
    .
    ס
    .
    ןיידלאה
    1892-1964
    ,
    הילגנא
    ,
    הרא
    "
    ודוהו ב
    ויבתכ ןיב
    :
    "
    הירואית
    תיעבט הרירב לש תיטמתמ
    תיתוכאלמו
    "
    ,
    "
    םימרוגה
    היצולובאל
    "
    ,
    "
    לדוגב תויהל
    ןוכנה
    "
    72 99 72
    עצוממ

    81
    םינש

    View Slide

  7. תויסולכוא לש הקיטנג
    7
    ג
    '
    תימס דרניימ ןו
    '
    1920-2004
    ,
    הילגנא
    םיקחשמה תרות
    תינויצולובאה
    ,
    היצולובאה
    תינימה הייברה לש
    ,
    הרירבה לש התלועפ
    תונוש תומרב תינימה
    ג
    '
    פ סמיי
    .
    וארק
    1916-2012
    ,
    הרא
    "
    ב
    היצטומ יבצק תדידמ
    לע תויצטומ תעפשהו
    תורישכה
    ,
    דועו דועו דועו
    הרומיק וטומ
    1924-1994
    ,
    הראו ןפי
    "
    ב
    ויבתכ ןיב
    :
    "
    הירואית
    תיעבט הרירב לש תיטמתמ
    תיתוכאלמו
    "
    ,
    "
    םימרוגה
    היצולובאל
    "
    ,
    "
    לדוגב תויהל
    ןוכנה
    "
    84 96 70
    78 היה 2010-ב ב"הראב עצוממה
    םינש 83 – עצוממ

    View Slide

  8. ע היצולובא
    "
    תויסולכוא לש הקיטנג פ

    ךילהתב השרוהב תורבועש תונוכת תוחיכשב יוניש
    בר
    -
    ירוד

    םייזכרמה תוחוכה
    :

    הרירב
    selection

    היצטומ
    mutation

    תינימ הייבר
    sexual reproduction

    תיארקא הפיחס
    random drift
    8

    View Slide

  9. ע היצולובא
    "
    תיעבט הרירב י
    9

    View Slide

  10. תורישכב תונוש

    תורישכב תונושה
    =)
    תיתייבר החלצה
    (
    הכירצ
    השרוהב רובעל

    איה השרוהב תרבועש תונושה
    תיטנג תונוש

    קר אל
    -
    הקיטנגיפא
    ...
    פורפ
    '
    הקנולבי הוח
    ,
    18.4

    תיטנגה תונושה תרצונ דציכ
    ?
    10

    View Slide

  11. היצטומ
    -
    תוישופיח
    םיקורי םירוה
    -
    CGTCGACGTGCAAATTTGGGCTGGCA
    םוח אצאצ
    -
    CGTCGACGTGCATATTTGGGCTGGCA
    11

    View Slide

  12. היצטומ

    תישמרח הימנא

    ןגב תיתדוקנ היצטומ
    ןיבולגומהה ןובלחל

    CTC → CAC

    ונימאה תצמוח תא הפילחמ
    glutamic acid
    ב
    -
    valine

    םודאב ןיקת ןיבולגומה

    םותכב ישמרח ןיבולגומה
    12

    View Slide

  13. היצטומ
    13

    "
    תויצטומ
    ...
    היצולובאל םלגה רמוח תא תוקפסמ
    "

    זבוד
    '
    יקסנ
    ,
    םינימה אצומו הקיטנג
    1937

    "
    תלעופ הילעש תונושל יסיסבה רוקמה ןה תויצטומ
    תיעבטה הרירבה
    "

    ץניל
    ,'
    2007

    תירבעב
    -
    תינשת

    View Slide

  14. תיטנג תונושל תורוקמ דוע

    םיקתועה רפסמב תונוש

    תינימ הייבר

    היצגרגס

    היצניבמוקר
    14
    http://www.nature.com/nature/journal/v468/n7327_supp/full/468S13a.html
    http://www.nature.com/ng/journal/v39/n10/full/ng2123.html
    זאלימעה ןג יקתוע רפסמ
    היסולכואב תוחיכש היסולכואב תוחיכש

    View Slide

  15. ילרטינהו ערה בוטה
    15

    View Slide

  16. תויצטומ אלל טרפל סחיב תורישכ
    תוחיכש
    ילרטינהו ערה בוטה
    16
    תויצטומ לש תורישכה תוגלפתה
    ב
    סוריו
    VSV
    17637733
    pubmed/
    gov/
    nih.
    nlm.
    ncbi.
    www.
    ://
    http
    תוילילש תויצטומ
    תויבויח
    תוילרטינ

    View Slide

  17. ילרטינהו ערה בוטה
    17
    ב תויצטומ לש תורישכה תוגלפתה
    הייפאה רמש
    17637733
    pubmed/
    gov/
    nih.
    nlm.
    ncbi.
    www.
    ://
    http
    תוילילש תויצטומ
    תוילרטינ
    תוחיכש
    תורישכ

    View Slide

  18. העובק הביבסב היצולובא
    18

    View Slide

  19. תועובק תוביבס היצולובא

    תיעבטה הרירבה לש הלועפה ןוויכב יוניש ןיא

    ןיב לקשמ יוויש
    תיעבט הרירב
    ו
    היצטומ
    19

    View Slide

  20. טושפ יטמתמ לדומ

    םיללא ינש לעב דחא ןגב דקמתנ
    )
    תואסרג
    (

    יעבטה ללאה
    A
    ללאהמ רתוי ההובג תורישכ לעב
    טנטומה
    B
    -
    > ()

    ללאה תוחיכשב יונישה תא ראתמ לדומה
    A
    -
    ()
    -
    רודל רודמ
    :
    5678
    =
    59:
    ( )

    20

    View Slide

  21. לקשמ יוויש תאיצמ
    וב בצמ אוה לקשמ יוויש
    רודל רודמ יוניש ןיא
    :
    G8HIJ6
    = 5678
    = 59:
    םילבקמ ונחנא ןכלו
    :
    G8HIJ6
    =
    G8HIJ6
    ( )

    תוחיכשב הקולחו תעצוממה תורישכב הלפכה ידי לעו
    A
    :
    = ( )
    21

    View Slide

  22. לקשמ יווישב תעצוממ תורישכ
    התייה יסאלקהו טושפה לדומה תאצות

    = ( )
    םילימב וא
    :
    "
    תורבתסהל הווש היסולכואב תעצוממה תורישכה
    תושחרתמ ןניא תויצטומש
    "
    הכומנ תורישכל ליבומ הובג היצטומ בצק רמולכ
    ...
    22

    View Slide

  23. תיעבטה הרירבל היצטומ ןיב לקשמ יוויש
    תואצות
    לש
    תויצלומיס
    23

    View Slide

  24. תועובק תוביבסב היצטומה בצק

    "
    הווש היסולכואב תעצוממה תורישכה
    תושחרתמ ןניא תויצטומש תורבתסהל
    "

    היצטומה בצק תא דירות תיעבטה הרירבה

    ולש ןותחתה ףרה לע בצייתי היצטומה בצק
    תיגולויזיפ הניחבמ
    /
    תילקיזיפ
    )
    הרומיק
    ,
    1967
    (
    24

    View Slide

  25. הנתשמ הביבסב היצולובא

    שי תונתשמ תוביבסב
    רובעל לוכיש ימל ןורתי
    המאתה
    )
    היצטפדא
    (
    הריהמ

    ךרוצה ןיב ןזאל שי
    ןיבו הריהמ המאתהב
    ע םרגנש קזנה
    "
    י
    תוילילש תויצטומ
    25

    View Slide

  26. םיקדייחל םירגתא
    26
    ע ףקתומ סקרטנאה קדייח
    "
    י
    ןוסיחה תכרעמ
    סוארואא סוקוקוליפטס
    םע תחלצ לע
    הקיטויביטנא
    םיסוריו
    קדייח םיפקות

    View Slide

  27. םינומיל ךל םינתונ םייחהשכ

    רתוי הריהמ המאתה רשפאמ הובג היצטומ בצק
    םייתביבס םירגתאל

    תא שי הנוכנה היצטומה תא גישמש ןושארל
    היסולכואה לע טלתשהל רתויב בוטה יוכיסה
    27

    View Slide

  28. היצטומה בצקב תונוש
    םינימ ןיב
    דודמל ןתינש רודל עצוממה תויצטומה רפסמב םיראותמ םיבצקה
    28
    םיבובז
    :
    0.455
    Keightley et al. 2009
    םיקדייח
    :
    0.0004
    Wielgoss 2011
    םדא ינב
    :
    41
    Lynch PNAS 2010

    View Slide

  29. היצטומה בצקב תונוש
    תויסולכוא ןיב
    29
    ש היצטומה בצק
    -
    69
    ילוק יא יקדייח לש תויעבט תויסולכוא
    Matic et al. 1997

    View Slide

  30. טרפה ךותב
    30
    היצטומה בצקב תונוש
    זרמילופ אנד לש תואיגשה בצק

    Lynch 2011
    םיקדייח
    םירמש
    םדא ינב
    30

    View Slide

  31. הקע תירשומ היצטומ
    ילוק יאב
    :
    הטונש זרמילופ אנד
    ע לעפומ תואיגשל
    "
    י
    הקע תובוגת
    :

    תבוגת
    SOS

    בער

    ל קזנ
    -
    DNA
    31
    Rosenberg et al. 2012
    31

    View Slide

  32. תויודע
    הקורי הצא
    קדייח
    סוליצב
    תינסיסת
    רקחמה
    הדוטמנ
    תפחשה קדייח
    ילוק יא קדייח
    קדייח
    הירטסילה
    32
    דשה ןטרס את

    View Slide

  33. הקע תירשומ היצטומ לש היצולוב

    ספאה תרעשה
    :
    הקע לש יאוול רצות איה היצטומ

    אל תיביטנרטלא הרעשה
    -
    תויביטפדא
    :
    ההובג תונמאנב אנד לופכש ריחמ
    33

    תיביטיפדאה הרעשהה
    :
    יכ תחתפתמ הקע תירשומ היצטומ
    תויסולכואו םיטרפל רשפאמ איה
    תושדח תוביבסל תוריהמב םיאתהל
    ילוק יא

    View Slide

  34. הקע הרשומ בצק
    ךומנ בצק
    הובג בצק
    תיביטפדאה הרעשהה
    34

    View Slide

  35. תירשומ היצטומ לע רקחמה תריקס
    -
    הקע

    היצולובאה
    לש
    הקע תירשומ היצטומ

    תיביטפדאה הרעשהה לש הקידב

    היצולבא
    םע
    הקע תירשומ היצטומ

    תובכרומ תונוכת

    הקיטויביטנאל תוניסח

    ןטרס
    35
    םיפואה רמש

    View Slide

  36. תועובק תוביבס

    יטמתמ לדומ
    תורישכה לש תואוושמה תכרעמ לש יללכה ןורתפה
    תיעבט הרירבו היצטומ ןיב לקשמ יווישב
    :


    +
    7
    =
    + − 7
    "
    םע םיטרפ לש היצטומה בצק תרבגה
    תא הלידגמ עצוממל תחתמ תורישכ
    היסולכואב תעצוממה תורישכה
    "
    36

    View Slide

  37. היצטומה בצק תרבגה
    תועובק תוביבס

    עובק היצטומ בצק
    37
    תעצוממה תורישכב יוניש

    View Slide

  38. היצטומה בצק תרבגה
    תועובק תוביבס

    הקע הרשומ היצטומ בצק
    38
    תעצוממה תורישכב יוניש
    תויצטומ םע
    תויבויח
    תויבויח תויצטומ אלל

    View Slide

  39. Cambia todo cambia
    39
    הסוס סדסרמ
    ,
    1935-2009
    ,
    תרמז
    תיאניטנגרא
    המודאה הכלמה
    ,
    ךותמ
    "
    הארמל דעבמ
    םש האצמ סילא המו
    / "
    לורק סיאול
    ,
    1871

    View Slide

  40. תונתשמ תוביבס
    -
    בשחמ תויצלומיס
    40
    הריחב
    תיארקא
    לש
    טרפ
    טרפה
    רחבנה
    תמ
    הריחב
    תיולת
    תורישכ
    לש
    טרפ
    טרפה
    רחבנה
    הברתמ
    אצאצה
    רבוע
    היצטומ

    View Slide

  41. עובק בצק חצנמ הקע הרשומ היצט
    0.05
    41
    תוחיכש
    תרשומ היצטומ
    הקע
    תונוחצנ
    םידספה
    תורוד

    View Slide

  42. םוכיס
    :
    םיינויצולובאה םימרוגה

    בצק
    היצטומ
    הקע הרשומ
    ףדעומ
    בצק ינפ לע
    ע עובק
    "
    י
    תיעבטה הרירבה

    תונתשמ תוביבסב םגו תועובק תוביבסב םג

    ה לע העפשהה ללגב
    המאתה רובעל תלוכי
    הביבסל

    evolvability

    תיביטפדאה הרעשהב הכימת
    42
    ירוליפ רטקבוקילה

    View Slide

  43. ךיא
    היצטומ בצק עיפשמ
    היצולובאה לע הנתשמ
    ?
    43
    מממ
    ...
    םיטוירקואא
    תוירטפ
    זנוימ
    תירשומ היצטומ םע היצולובא
    הקע

    View Slide

  44. היצולובאב החותפ היעב
    ע הגצוה היעבה
    "
    ב טייר לוויס י
    -
    1931
    :
    רפסמ תושורד השדח המאתהל םא
    תויצטומ
    ,
    איה דרפנב היצטומ לכ ךא
    תילילש
    ,
    המאתהה חתפתת דציכ
    ?
    44
    Wright, 1988

    View Slide

  45. תובכרומ תונוכת לש היצולובא
    ןוירטירק

    המאתה רובעל תוכירצ רתוי וא תונוכת יתש

    תורישכב הדיריל םרוג דבלב תחא הנוכתב יוניש
    תומצעו םייפנכ

    תינזבזב איה תודבכ תומצע םע הפועת

    תנכוסמ איה תולק תומצע םע סופיטו הכילה
    ןמחפ רוקמ
    )
    רכוס
    (
    שדח

    םישדח םינובלח ינש םיצוחנ
    ,
    ינשה אלל ינזבזב דחא לכ
    :

    אתה ךותל רכוסה תסנכהל הבאשמ

    רכוסה לוכיעל םיזנא
    תרושקתו הפש

    הפירטל טרפה תא ףשוח רודיש

    תשעורו תינזבזב איה הטילק 45
    warksbats.co.uk
    Xiao et al. 2011

    View Slide

  46. טושפ תורישכ ףונ
    46

    View Slide

  47. טושפ תורישכ ףונ
    47
    שיגר
    שיגר תוחפ
    שיגר אל

    View Slide

  48. בכרומ תורישכ ףונ
    48

    View Slide

  49. בכרומ תורישכ ףונ
    49
    םייפנכ ןיא
    תודבכ תומצע
    םייפנכ ןיא
    תולק תומצע
    םייפנכ שי
    תולק תומצע

    View Slide

  50. רתוי ההובג תורישכ תגספל רבעמ
    50
    הגספ
    הכומנ
    קמע
    ההובג הגספ

    View Slide

  51. בכרומ תורישכ ףונב הקע תירשומ היצטומ
    51
    ךומנ היצטומ בצק
    הובג היצטומ בצק
    בצק תרבגה
    היצטומה
    םיטרפב
    םיאצמנש
    ל תחתמ
    יתש
    תורישכה תוגספ

    View Slide

  52. בכרומ תורישכ ףונב הקע תירשומ ה
    52
    אלמ בוריק
    יקלח בוריק
    תויצלומיס תואצות
    היצטומה בצק תרבגה
    ההובגה הגספל רבעמל ןמז
    ךומנ עובק היצטומ בצק

    View Slide

  53. םוכיס
    :
    תובכרומ תונוכת לש היצולובא

    הקע הרשומ היצטומ בצק
    ץיאמ
    היצולובאה תא
    תובכרומ תונוכת לש

    מ היצולובאב החותפ היעבל הנעמ ןתונ
    -
    1931
    53

    View Slide

  54. הקיטויביטנאל תוניסח
    54

    View Slide

  55. ןיליצינפל תוניסח
    םיקינעמש םימיזנא לש בר רפסמ
    תוניסח
    ןיליצינפל
    55
    הנש
    והוזש םינושה םימיזנאה רפסמ
    2009
    -
    900
    1989
    -
    100
    Davies and Davies 2010

    View Slide

  56. "
    ישמה ךרד
    "
    גוסמ תוניסח לש
    CTX-M
    56
    a - ןונבל
    b – לארשי
    c - תיווכ
    Davies and Davies 2010

    View Slide

  57. הקיטויביטנאל תוניסח לש ילכלכה ריחמה
    57
    מ תוניסחה זוחא תדרוה
    -
    13.5%
    ל
    -
    10%
    ב
    -
    1,391
    םילוח
    :
    לש ןוכסח
    2.7
    רלוד ןוילימ
    וא
    1,948
    $
    הלוחל
    13.5% 10%
    Roberts et al,. 2009
    תיאופר תולע
    תיתרבח תולע

    View Slide

  58. הקיטויביטנאל תוניסח לש היצולובא
    58
    םילוח תיב
    הליהק
    םע םילוח
    שיגר קדייח
    םע םילוח
    ןיסח קדייח
    1
    #
    םע םילוח
    ןיסח קדייח
    2
    #
    אלל םילוח
    קדייח
    לדומה
    :

    םילוח תיב

    קדייח

    תונוש תופורת יתש
    תוינידמ
    ןתמ
    תיבב הקיטויביטנא
    םילוח
    :

    תוירוזחמ

    תפלחה
    לכ הפורתה
    םוי
    /
    עובש
    /
    שדוח

    בוברע

    הפורתה תפלחה
    עיגמש הלוח לכל

    בוליש

    תופורת יתש ןתמ
    ליבקמב
    Bergstrom et al., 2004

    View Slide

  59. הקימנידה תא הנשמ הקע הרשומ היצטומ בצק
    59
    הלופכ תוניסח תעפוה
    היצטומה בצק תרבגה
    תוירוזחמ
    בוברע
    בוליש
    Ubolski and Hadany, 2012

    View Slide

  60. םוכיס
    :
    הקיטויביטנאל תוניסח לש היצולובא

    תוינידמה תא הנשמ הקע הרשומ היצטומ בצק
    ל הפידעה
    הלופכ תוניסח לש העפוהה םוצמצ
    הקיטויביטנאל
    60

    View Slide

  61. ןטרס לש היצולובא
    61
    הלגיש קדייח תואיר ןטרס
    תינומרעה תוטלב ןטרס הזוניגרא סנומודספ

    View Slide

  62. הקע תירשומ היצטומו ןטרס

    תתב םיינטרס םיאת
    -
    בצק תא םיריבגמ ןצמח
    היצטומה

    יתועמשמ םרוג תויהל הלולע היצטומ
    :

    היפרתומיכל תוניסח תוחתפתהב

    ןטרסה לש תומדקתהב
    )
    היסרגורפ
    (

    ןטרסה תוטשפתהב
    )
    סיזטסאטמ
    (

    ידיתע רקחמ ןוויכ
    62

    View Slide

  63. םוכיס

    בצק
    היצטומ
    הרשומ
    הקע
    ףדעומ
    בצק ינפ לע
    ע עובק
    "
    י
    ה
    תיעבטה הרירב

    תוביבסב םג
    תועובק
    תוביבסב םגו
    תונתשמ

    ה בצקה תא ץיאמ
    היצולובא
    תובכרומ תונוכת לש

    הקיטויביטנא ןתמל תפדעומה תוינידמה תא הנשמ
    יבב
    "
    ח

    ןטרסה תלחמב םרוג תויהל יושע
    63
    [email protected]
    @yoavram
    http://www.yoavram.com

    View Slide