Bone Dysplasia Diagnosis in the Genomics Era

Presentation for the Pediatrics Endocrine Educational Dinner in Brisbane in February 2017.

Transcript

1. Andreas Zankl MD, FMH, FRACP, PGCert Bioinf. Professor of Medical Genetics, The University of Sydney Head, Bone Dysplasia Clinic, Children’s Hospital at Westmead Diagnosis of Skeletal Dysplasias in the Genomics Era
2. Bone Dysplasia Clinic • >400 bone dysplasia patients • diagnosis and management
5. Classification 1878 Description of “Achondroplasia” 1929 Description of “Morquio Syndrome” 1970 First International Nosology of Constitutional Diseases of Bone 2010 7th Revision of the Nosology: > 450 disorders 1970 1929 1878 2010
6. knowing the diagnosis is important • different recurrence risks • different types of complications • different management • specific treatments
8. Diagnosis of Skeletal Dysplasias • History • Physical exam • Radiographs • Investigations • Genetic testing
9. onset and progression of symptoms: • prenatal: TD, ACG, OI, SRP • birth: ACH, SEDC • first years of life: PSACH, HCH, CHH • after 3 years: MED, brachyolmia, SED tarda → important to have good growth charts! history
10. history associated medical problems: • cleft palate, myopia, hearing loss: type II collagenopathies • intellectual impairment: LSD, Dyggve-Melchior-Clausen • hematological abnormalities: CHH, Shwachman
11. family history • “short stature” • “arthritis” • “joint pain”
12. Grebe Dysplasia Brachydactyly C
14. physical examination US LS rhizo- meso- acro-
15. short trunk vs short limbs
16. other clues Nail-Patella Syndrome Diastrophic Dysplasia
17. Radiographic Evaluation - Full Skeletal Survey
18. Basic Skeletal Survey • skull lateral • thorax AP • spine lateral • pelvis AP (including lower spine and proximal femurs) • knees AP • hand AP (including wrists)
19. Extended Skeletal Survey • skull AP • spine AP • knees lateral • upper extremity AP • lower extremity AP • cervical spine lateral (extension, flexion)
20. what to look for • bone structure • timing of ossification • primary sites of involvement • bone shape • specific signs • the big picture
21. osteopetrosis osteolysis bone structure
22. osteopoikilosis melorheostosis bone structure
23. timing of ossification always record the age when xrays were taken!
24. primary site of involvement metaphyseal- epiphyseal- spondylo-
25. spondyloepiphseal dysplasia congenita ≠ spondyloepiphyseal dysplasia tarda (X-linked) ≠ spondyloepiphyseal dysplasia tarda (AR)
26. mucopolysaccharidosis achondroplasia shape
27. shape “wafer-thin” Thanatophoric dysplasia I “hook-shaped” mucopolysaccharidoses “anterior tongue” pseudoachondroplasia
28. specific signs
29. french telephone receiver sign
 (thanatophoric dysplasia type 1)
30. monkey wrench sign Desbuquois Dysplasia
31. “Schneckenbecken” (snail pelvis) dysplasia
32. “angel-shaped” phalanx angel-shaped phalango-epiphyseal dysplasia (ASPED)
33. The Big Picture
36. C D J-shaped sella
37. tapering of proximal metacarpals bullet shaped phalanges
38. broad clavicles broad ribs
39. D dysostosis multiplex in the skull. (A) normal J-shaped sella turcica, (B) ab the skull of a patient with normal diploic plates and mildly abnormal J-shap loic plates and severe J-shaped sella (arrows) A B x in the thorax. Radiographs showing (A) a normal chest and (B) a chest of an MPS patient showing cles (arrows). en characterized by apering of the ilea the ileum merging of region. Inferior isorders. A newly The hands of MPS patients typically show proximal- ly pointed metacarpals. Metacarpals can be short and thick with thin cortices, even if proximal pointing is not present. Nonspecific findings include hypoplastic and irregular carpal bones, and irregularlyshaped tarsal t a critical aspect in MPS (partic- e if the spinal cord is compressed, result. MRI is more appropriate l cord alterations. hape of vertebral bodies are very attened and rounded vertebrae mbar level the vertebral body can terosuperior corner and, as a con- ongation of the anteroinferior one, ay in an “anterior beaking” aspect. nterior corners occurs, the vertebral LSD
40. age-dependent changes birth 1 year 4 years 5 years 14 years
41. age-dependent changes 12 days 4 months 9 months 5.5 years
42. Genetic Testing
43. The Human Genome 3 billion base pairs
44. …ACGTACGTACCTACGTACGT…
45. Sequencing
46. Sanger Sequencing • reads ~1000 bp (~1 exon) per experiment • each experiment requires manual preparation • manual preparation has to be optimised for each gene • COL1A1 has 52 exons • 52 experiments • ~2 days work
47. Genetic Testing by Sanger Sequencing • expensive (~US$2000 per gene) • slow (labs run tests only few times a year) • incomplete (most labs only offer tests for a small number of genes)
48. Genetic Testing by Sanger Sequencing • high quality • sequence • interpretation
49. Next Generation Sequencing Massively Parallel Sequencing Shot gun Sequencing
50. An analogy http://gcat.davidson.edu/phast/ Speed-reading a book by shredding it to pieces
52. 2014: The $1000 Dollar Genome
54. The industrial revolution in genetic testing
55. Challenges • Coverage • Data Volume • Bioinformatics Capacity • Interpretation
56. Coverage
57. sequencing error or heterozygous mutation?
58. complete coverage is hard to achieve… … especially in Whole Exome Sequencing and similar approaches
59. Gap-filling
60. Data Volume • 1 Human Genome (30x) = 100 GB • Illumina X Ten: 18’000 Genomes per year = 1.8 PB • 1’800 1TB hard drives per year!
61. sequencing is outgrowing storage capacity 1990 1992 1994 1996 1998 2000 2003 2004 2006 2008 2010 2012 0 1 10 100 1,000 10,000 100,000 1,000,000 0.1 1 10 100 1000 10,000 100,000 1,000,000 10,000,000 100,000,000 Year Disk storage (Mbytes/$) DNA sequencing (bp/$) Hard disk storage (MB/$) Doubling time 14 months Pre-NGS (bp/$) Doubling time 19 months - NGS (bp/$) Doubling time 5 months
62. Requires massive IT infrastructure and bioinformatics skills • maintain huge data storage and HPC • manually update tools, databases etc. • keep up-to-date with latest developments
63. Interpretation • WGS detects approx. 4 Million variants in each Human Genome • which one is responsible for the patient’s disease? • “finding a needle in a haystack of needles”
64. Assessing mutation pathogenicity is hard • computer predictions are only 80% accurate
65. Assessing mutation pathogenicity is hard • reviewing the medical literature is time-consuming • many mutations have never been reported • the medical literature is full of errors
66. Assessing pathogenicity is hard • every healthy human in the 1000 Genomes Project carries approx. 100 disease causing mutations Xue et al. Am J Hum Genet. 2012 Dec 7; 91(6): 1022–1032
67. The Interpretive Gap
69. The key to successful genetic testing is clinical correlation “genotype without phenotype leads to missense or nonsense” David Rimoin
70. Patients R and N anauxetic dysplasia
71. Anauxetic dysplasia • caused by mutations in RMRP • RNA component of the RNase MRP ribonucleoprotein complex • no RMRP mutations identified in Patient R and N Figure 8. Model for the human RNase MRP complex. Using the data obtained in this study and previously published UV-crosslinking data (25), a structural model for the human RNase MRP complex was generated. In this model, all detected protein±RNA interactions, except for the interaction of Rpp21, which seemed to be non-speci®c, are combined with all detected protein±protein interactions, except for the most weak interactions. Note that the size of the de- picted subunits is not proportional to their molecular masses. 2144 Nucleic Acids Research, 2004, Vol. 32, No. 7
72. Anauxetic dysplasia • caused by mutations in RMRP • RNA component of the RNase MRP ribonucleoprotein complex • no RMRP mutations identified in Patient R and N • Whole Exome Sequencing: • mutation in POP1 Figure 8. Model for the human RNase MRP complex. Using the data obtained in this study and previously published UV-crosslinking data (25), a structural model for the human RNase MRP complex was generated. In this model, all detected protein±RNA interactions, except for the interaction of Rpp21, which seemed to be non-speci®c, are combined with all detected protein±protein interactions, except for the most weak interactions. Note that the size of the de- picted subunits is not proportional to their molecular masses. 2144 Nucleic Acids Research, 2004, Vol. 32, No. 7 PLoS Genet. 2011 Mar;7(3):e1002027.
73. Incidental Findings • a mutation in a disease gene unrelated to the patient’s problem • e.g. BRCA mutation in a patient with short stature • a blessing or a curse?
74. Applications of NGS in the Clinical Setting • Whole Genome Sequencing • Whole Exome Sequencing • “Clinical Exome” • Gene Panels
75. Whole Genome Sequencing The Gold Standard • includes everything • good (even) coverage, few gaps • expensive • hard to handle • hard to interpret (too many variants, non-coding variants) • ethical issues (e.g. VOUS, incidental findings)
76. Whole Exome Sequencing Protein coding parts of genome only (1%) • cheaper • easier to handle and interpret • not all human disease mutations are in the Exome • not all genes covered well (‘gaps’) • same ethical issues
77. “Clinical Exome” (Illumina TruSightOne) Protein coding parts of ~8000 genes with known disease associations • cheaper • easier to handle and interpret • limited scope • gaps • quickly out date • ethical issues
78. Gene Panels panel of genes for specific conditions (e.g. bone fragility, skeletal dysplasias) • cheaper • usually good coverage for genes of interest • easier to interpret • few ethical issues • limited scope • quickly out date
79. Cost Accuracy Versatility Ethical Issues Find your sweet spot
80. Our approach • Research • Whole Genome Sequencing • Clinical Care • Panels based on TruSightOne (Clinical Exome) • Panels based on Whole Genome
81. Research Whole Genome Sequencing • most complete analysis available • data handling very challenging • funding for 200 Whole Genomes • still accepting samples • free of charge
82. Gene Panels based on TruSightOne • Osteogenesis imperfecta panel (13 genes) • Hereditary rickets panel (9 genes) • Custom skeletal dysplasia panel (on demand) • relatively cheap (AU$1200-1500) • few ethical issues • some gaps (but some gap filling) • does not cover some of the rarer genes • turnaround time 3-4 months
83. Gene Panels based on Whole Genome • under development • covers all genes of interest with very high quality • can detect duplications and deletions • can be re-analysed in the future if needed • few ethical issues through panel approach • cost?
84. overseas options • CTGT (www.ctgt.net) • single genes, panels • quick turnaround (2-4 weeks) • reasonably priced ($US500-2000)
85. but remember: The key to successful genetic testing is clinical correlation
86. Clinical assessment remains important • to decide which test/panel to order • to interpret the results