Log 05/03

Transcript

1. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 1 m i R N A - S e q a d a p t e r t r i m m i n g , T C G A P r o j e c t R e s u l t  Work Log 05/03
2. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 2 Illustration of different constructs and the reads produced. •  In = Inserts •  R = single-end reads •  R1, R2 = paired-end reads A)  ln.length ≥ R.length B)  In.length < R.length C)  In.length ≥ 2x R.length D)  R.length < In.length < 2x R.length E)  In.length < R.length
3. Adapter Trimming – using Cutadapt •  MIT Licensed, actively maintained •  Able to handle multi-adapters •  Allow matching error, quality check •  Detection at different position •  Fast with detailed report •  Python embedding C module •  Taken pair-end reads together (in dev) Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 3
4. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 4 Before Trimmed
5. Result – 1st Run •  Adapter sequence (length = 69) TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Maximum error rate: 10.00% No. of adapters: 1 Processed reads: 7968372 Processed bases: 804805572 bp (804.8 Mbp) Trimmed reads: 7764654 (97.4%) Quality-trimmed: 59716594 bp (508.2 Mbp) (7.42% of total) Trimmed bases: 508188865 bp (508.2 Mbp) (63.14% of total) Too short reads: 51386 (0.6% of processed reads) Too long reads: 0 (0.0% of processed reads) Total time: 555.33 s Time per read: 0.07 ms Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 5
6. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 6 Mapping Result – 1st Run, R1 of pair-end
7. length of being trimmed per read Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 7 0" 500000" 1000000" 1500000" 2000000" 0" 20" 40" 60" 80" 100" Expected"(Rand)" Trimmed"
8. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 8
9. Result – 2nd Run Maximum error rate: 10.00% No. of adapters: 1 Processed reads: 7713268 Processed bases: 229515361 bp (229.5 Mbp) Trimmed reads: 3827577 (49.6%) Quality-trimmed: 180344 bp (117.8 Mbp) (0.08% of total) Trimmed bases: 117799429 bp (117.8 Mbp) (51.33% of total) Too short reads: 3827607 (49.6% of processed reads) Too long reads: 0 (0.0% of processed reads) Total time: 295.97 s Time per read: 0.04 ms === Adapter 1 === Adapter 'unknown_hifreq' (GCATTGGTGGTTCAGTGGTAGAATTCTCGCC), length 31, was trimmed 3827577 times. Lengths of removed sequences length count expected max. errors 28 6792 0.0 2 29 66555 0.0 2 30 703674 0.0 3 31 3049065 0.0 3 32 1333 0.0 3 33 105 0.0 3 34 53 0.0 3  9
10. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 10
11. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 11 TCGA project
12. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 12 TCGA project
13. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 13
14. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 14
15. Bioinformatics and Biostatistics Core, NTU Center of Genomic Medicine 15