Upgrade to Pro — share decks privately, control downloads, hide ads and more …

2 встреча — Биоинформатика (А. Фединцев)

2 встреча — Биоинформатика (А. Фединцев)

2 встреча Smolensk Computer Science Club
Презентация Александра Фединцева про биоинформатику
ВКонтакте: http://vk.com/scsc2
Видео: https://www.youtube.com/watch?v=b3TZEeeIQ1c

Transcript

  1. Что такое биоинформатика? - математические методы компьютерного анализа в сравнительной

    геномике (геномная биоинформатика). - разработка алгоритмов и программ для предсказания пространственной структуры белков (структурная биоинформатика). - исследование стратегий, соответствующих вычислительных методологий, а также общее управление информационной сложности биологических систем.
  2. ДНК

  3. Синтез белка

  4. Краткая история секвенирования генома 2000-е: расшифровывается всё большее число геномов

    млекопитающих.
  5. Секвенирование генома: иллюстрация Много копий генома

  6. Секвенирование генома: иллюстрация Много копий генома Чтение ридов

  7. Секвенирование генома: иллюстрация Много копий генома Риды Чтение ридов

  8. Секвенирование генома: иллюстрация Много копий генома Риды Чтение ридов Сборка

    фрагментов
  9. Секвенирование генома: иллюстрация Много копий генома Риды Собранный геном …GGCATGCGTCAGAAACTATCATAGCTAGATCGTACGTAGCC…

    Чтение ридов Сборка фрагментов
  10. None
  11. Секвенирование сложнее задачи о газете • В каждом геноме есть

    много повторяющихся подстрок (50% человеческого генома — повторения). • Пример: GCTT встречается четыре раза в строке AAGCTTCTATTGCTTAATTGGCTTGCTTCGCTTTG • Аналогия: треугольный пазл содержит множество повторяющихся фигур. Это сильно затрудняет его решение (даже с 16 кусочками).
  12. ДНК-чипы: реализация 1. Синтезировать все k-меры в каждой из 4k

    ячеек матрицы. 2. Покрыть матрицу многими копиями флуоресцентно помеченного фрагмента неизвестной ДНК. 3. ДНК гибридизирует с k-мером, если они дополняют друг друга. 4. Использовать спектроскоп, чтобы определить, какие ячейки излучают свет — дополнения к этим ячейкам выявят k-меры неизвестного фрагмента ДНК. Это и есть искомые риды!
  13. ДНК-чипы: иллюстрация

  14. ДНК-чипы: пример Прочитанные риды: AAA AGA CAA CGA GAA GGA

    TAA TGA AAC AGC CAC CGC GAC GGC TAC TGC AAG AGG CAG CGG GAG GGG TAG TGG AAT AGT CAT CGT GAT GGT TAT TGT ACA ATA CCA CTA GCA GTA TCA TTA ACC ATC CCC CTC GCC GTC TCC TTC ACG ATG CCG CTG GCG GTG TCG TTG ACT ATT CCT CTT GCT GTT TCT TTT
  15. Первый подход: граф H Создадим в графе H вершины, соответствующие

    всем k-мерам, найденным с помощью ДНК-чипа. Префикс — это первые k – 1 нуклеотидов k- мера (CAA) Суффикс — последние k – 1 нуклеотидов k- мера(CAA) Разные 3-меры могут иметь общий префикс/суффикс: ATG, TGA, CTG ATG CGT GGC AAT GTG TGG TGC CAA GCA GCG
  16. Гамильтонов цикл в графе H В графе H есть гамильтонов

    цикл: ATG CGT GGC AAT GTG TGG TGC CAA GCA GCG
  17. Гамильтонов цикл в графе H В графе H есть гамильтонов

    цикл: • ATG  TGG  GGC  GCG  CGT  GTG  TGC  GCA  CAA  AAT  ATG ATG TGG GGC GCG CGT GTG TGC GCA CAA AAT ATG ATGGCGTGCAATG Геном: A T G G C G T G C A
  18. Второй подход: граф E Сформируем иной граф E следующим образом:

    Вершины = все префиксы и суффиксы всех k-меров. Соединим вершины v и w ориентированным ребром, если есть k-мер, в котором префикс — это v, а суффикс — это w. CA GC CG TG GT GG AT AA TGC GGC CGT CAA AAT GTG GCG GCA ATG TGG Риды
  19. Второй подход: граф E Сформируем иной граф E следующим образом:

    Вершины = все префиксы и суффиксы всех k-меров. Соединим вершины v и w ориентированным ребром, если есть k-мер, в котором префикс — это v, а суффикс — это w. CA GC CG TG GT GG AT AA TGC GGC CGT CAA AAT GTG GCG GCA ATG TGG Риды ATG TGG GGC GCG CGT GTG TGC GCA CAA AAT
  20. Вопрос Де Брюйна 1946: голландский математик Николаас де Брюйн задаётся

    вопросом: как создать циклическую строку минимальной длины, которая содержала бы любую строку длины k из нулей и единиц? Например, k = 3. Круговая строка «00011101» содержит все 8 двоичных строк длины 3. (На иллюстрации — подстроки 000 и 110). Николаас де Брюйн
  21. Вопрос Де Брюйна Де Брюйн ввёл специальный граф B(n, k):

    Вершины = все nk – 1 возможных (k – 1)-меров над n-буквенным алфавитом. Ребро идет из v в w, если есть k-мер, чей префикс = v, а суффикс = w. Справа приведен B(2, 4) Подразумевается алфавит {0, 1}
  22. Вопрос Де Брюйна При любых n и k, B(n, k)

    является сблансированным и связным, а значит, эйлеровым. Почему? Потому что входящая и исходящая степень каждой вершины равняется n — размеру алфавита. Красные числа показывают порядок рёбер в эйлеровом цикле.