lecture-23 mol_gen

Transcript

1. Molecular Genetics
2. Nucleic Acids RNA •  Ribonucleic acid •  Binds AUGC •  Single Stranded •  Forms secondary, tertiary structures •  mRNA, tRNA... DNA •  Deoxyribonucleic acid •  Binds ATGC •  Double stranded •  Forms double helix •  Stores information Base pairing AT = two bonds GC = 3 bonds (H)
4. Replication Structure of a Chromosome •  Centromeres •  Telomeres •  P-arm/Q-arm •  Banding •  Several places where replication can start •  Need telomerase to form ends
5. Replication Cont… •  During s-phase •  Procarya one origin (circular •  Eucarya many Origins 10-300kb apart, •  ORC recognizes specific sites •  bi-directional 'bubbles' eventually join
6. Transcription <2% code for genes Structure of a gene •  tata box, 25-30 base pairs upstream from transcription start site, other promoter elements in other genes •  Many transcription factors may be involved including ones 3000kb upstream from start site •  Exons •  Introns •  UTRs General Transcription Factors (GTFs) are proteins that recognize promoter regions and bind RNA Polymerase Tata Binding Protein (TBP)
7. mRNA Processing 1.  5' N7-methylguanosine after 50-100 nucleotides are produced, enzymes! 2.  3’ Poly A tail 3.  Exons and Intron Slicing, need specific sequences and more enzymes 4.  Export to nucleus One gene one protein?
8. Translation 1. Processed mRNA leaves nucleus goes to cytoplasm 2. Small ribosomal subunit binds to mRNA and recruits initiation factors 3. 40s scans for start codon 4. Releases initiation factors, binds 60s ribosomal subunit and other proteins 5. tRNA (initiator, elongation) 6. Elongation codons, EPA exit, peptidyl, Anticodon Genetic code Redundancy
10. https://www.youtube.com/watch?v=41_Ne5mS2ls
11. Transposons Short Interspersed Nucleotide Elements (SINES) Long Interspersed Nucleotide Elements (LINES) contain the information they need to move around. Retrotransposons
12. Human Genome Browser •  Main Page •  Browser Page (ADH1B) o  Exons/Introns o  UTRs o  SNPs o  Template Strand/Orientation •  Description Page •  View •  Blat o  CCATGTGAATGTGATGGCCCCTTCCCGGGAGCTCTCACTGAACC •  In Silico PCR (if time)