Upgrade to Pro — share decks privately, control downloads, hide ads and more …

Investigating the evolution of structural varia...

Sponsored · Your Podcast. Everywhere. Effortlessly. Share. Educate. Inspire. Entertain. You do you. We'll handle the rest.

Investigating the evolution of structural variation in cancer

PhD Completion Seminar.

Avatar for Marek Cmero

Marek Cmero

July 17, 2017

More Decks by Marek Cmero

Other Decks in Science

Transcript

  1. Completion Seminar Investigating the evolution of structural variation in cancer

    Supervisors: Prof. Chris Hovens, Dr. Niall Corcoran, Dr. Geoff Macintyre, Dr. Cheng-Soon Ong and A/Prof. Tony Papenfuss Marek Cmero, PhD Candidate - Dept. Surgery/CiS
  2. Thesis summary • Developed a method to study clonal evolution

    of genome rearrangements • Applied method to 2700+ whole-genome pan-cancer samples • Developed strategies to test for evidence of clonal change in low-quality longitudinal samples • Applied methods to study treatment resistance in aggressive prostate cancer cohort
  3. chrA chrB Ref Donor Deletion Ref Donor Tandem duplication Ref

    Donor Translocation Ref Donor Interspersed duplication Ref Donor Inversion Inter-chromosomal translocation What is structural variation (SV)? Copy-number variation Balanced rearrangements chrA chrB Ref Donor Deletion Ref Donor Tandem duplication Ref Donor Translocation Ref Donor Interspersed duplication Ref Donor Inversion Inter-chromosomal translocation
  4. What’s a VAF? Estimating population frequency from Variant Allele Frequency

    (VAF) TCTTCATTTGCAGCTAGTCGTGTGGGCTTAGT TCTTCATTTGCAGCTAGTCGTGTGGGCTTAGT TCTTCATTTGCAGCTAGTCGTGTGGGCTTAGT TCTTCATTTGCAGCTAGTCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT Coverage = 10 A: 6 REF G: 4 SNV VAF = 4/10 = 40% REF: TCTTCATTTGCAGCTAATCGTGTGGGCTTAGT
  5. What is cancer cell fraction? Tumour (clone B) Tumour (clone

    A) CCF: 2/6 = 33.33’% CCF: 4/6 = 66.66’% We must infer clone CCFs from groups of variant CCFs
  6. Copy-number confounds CCF calculation VAF = 1 / (2 +

    3 + 4) = 11.11’% but CCF = 4 / 6 = 66.66’%
  7. Clustering using Bayesian Inference and MCMC • Define distributions for

    unknown parameters • Dirichlet process: number of clusters is dynamic • Iterative approach to simulate distributions that match the data using markov-chain monte- carlo (MCMC) • Extract CCFs and cluster memberships ϕj = population frequencies Zj = cluster gj = most likely copy-numbers dj = depth at variant locus bj = variant reads
  8. Summary • Developed pipeline for inferring cancer cell fraction from

    structural variant breakpoint data, using: • Rule-based read counting • Clustering using Bayesian Inference • Validated using • Simulations • In-silico real sample mixtures • Only method available that: • considers balanced rearrangements • provides comprehensive clonal deconvolution of breakpoints
  9. Application We apply the SVclone methodology to: • 2700+ pan-cancer

    samples • Aggressive prostate cancer cohort to study drug resistance
  10. Intratumour heterogeneity has important clinical implications Source: Aparicio, S., &

    Caldas, C. (2013). The Implications of Clonal Genome Evolution for Cancer Medicine. https://doi.org/10.1056/NEJMra1204892
  11. Case study: Neo-adjuvant prostate cancer cohort • 14 high-risk prostate

    cancer patients underwent neo- adjuvant ‘supercastration’ treatment • Biopsies were obtained prior to treatment and from a post- treatment prostatectomy • All pre-treatment samples were formalin fixed paraffin embedded (FFPE) • 27 samples underwent whole-genome sequencing • Coverage mean = 37.8x • Any evidence of clonal change in pre vs. post?
  12. Testing for subclonal shifts X bin Y bin count 0.00

    – 0.25 0.5 – 0.75 56 0.00 – 0.25 0.75 – 1.00 83 0.00 – 0.25 1.00 – 1.25 44 0.25 – 0.50 0.75 – 1.00 44 0.25 – 0.50 1.00 – 1.25 28 0.50 – 0.75 1.00 – 1.25 37 X bin Y bin count 0.00 – 0.25 0.00 – 0.25 0 0.00 – 0.25 0.00 – 0.25 0 0.00 – 0.25 0.00 – 0.25 0 0.25 – 0.50 0.25 – 0.50 0 0.25 – 0.50 0.25 – 0.50 1 0.50 – 0.75 0.50 – 0.75 17 Pre < Post counts Pre > Post counts Apply 1-tailed unpaired T-test in direction of shift – results imply selection
  13. Simulation results Simulated shift beta (dispersion) Coverage Clonal selection FDR

    Clonal shrinkage FDR 0.1 > 0.9 1 35 **0.040 1.0000 0.2 > 0.8 1 35 0.2203 1.0000 0.3 > 0.7 1 35 0.1656 1.0000 0.4 > 0.6 1 35 0.3563 1.0000 0.5 > 0.5 1 35 0.5000 1.0000 0.1 > 0.9 10 35 **0.011 1.0000 0.2 > 0.8 10 35 **0.0001 1.0000 0.3 > 0.7 10 35 **0.0006 1.0000 0.4 > 0.6 10 35 **0.0155 1.0000 0.5 > 0.5 10 35 0.5000 1.0000 0.1 > 0.9 100 35 **0.0223 1.0000 0.2 > 0.8 100 35 **0.0044 1.0000 0.3 > 0.7 100 35 **0.011 1.0000 0.4 > 0.6 100 35 **0.0401 1.0000 0.5 > 0.5 100 35 0.3627 1.0000 0.1 > 0.9 1000 35 **0.0401 1.0000 0.2 > 0.8 1000 35 **0.0111 1.0000 0.3 > 0.7 1000 35 **0.0124 1.0000 0.4 > 0.6 1000 35 **0.0216 1.0000 0.5 > 0.5 1000 35 0.3813 1.0000
  14. SVclone – clustering FFPE vs. fresh frozen ** ** **

    Poor purity estimates in RARP Good purity estimates
  15. SV filtering in FFPE samples Default filtering Require >1 spanning

    reads for inter-chromosomal translocations
  16. SVclone pre vs. post clustering results ** ** ** Poor

    purity estimates in RARP Selection?
  17. Summary • SVclone Pan cancer Analysis • Distinct SV/SNV heterogeneity

    patterns in diff. cancer types • Novel SCNR phenotype • Developed strategies to test for evidence of clonal change in low-quality longitudinal samples • Neo-adjuvant treatment cohort showed little evidence of changing clonal dynamics
  18. Acknowledgements The University of Melbourne/Royal Melbourne Hospital • *Dr. Christopher

    Hovens • *Dr. Niall Corcoran • Natalie Kurganovs • Stefano Mangiola • Kangbo Mo Cancer Research UK Cambridge Institute • *Dr. Geoffrey Macintyre • *Dr. Florian Markowetz (host supervisor) Data61/Australian National University • *Dr. Cheng-Soon Ong The Walter + Eliza Hall Institute • *Dr. Tony Papenfuss • Dr. Jan Schröder The University of Glasgow • Dr. Ke Yuan PCAWG Evolution and Heterogeneity Working Group (esp. Peter Van Loo, David Wedge and Stefan Dentro) People (*supervisors) Funding Thank you to Roger Riordan of the Cybec Foundation for his generous Urology Fellowship funding contribution Compute Advisory panel • Dr. HongJian Zhu, Dr. Andrew Lonie SVclone: https://github.com/mcmero/SVclone Preprint on bioaRxiv coming soon!
  19. Publications • 2017 • [Manuscript in preparation] Cmero, M., Ong,

    C.S., Yuan, K., Schröder, J., Kangbo, M., PCAWG Evolution and Heterogeneity Working Group, Corcoran, N.M., Papenfuss, T., Hovens, C.M., Markowetz, F., Macintyre, G. SVclone: inferring structural variant cancer cell fraction. • Gerstung, M. et al. [author 22 of 45] (2017). The evolutionary history of 2,658 cancers. bioRxiv 161562; doi: https://doi.org/10.1101/161562 • 2016 • Mangiola, S., Hong, M. K., Cmero, M., Kurganovs, N., Ryan, A., Costello, A. J., ... & Hovens, C. M. (2016). Comparing nodal versus bony metastatic spread using tumour phylogenies. Scientific Reports, 6. • Stuchbery, R., Macintyre, G., Cmero, M., Harewood, L. M., Peters, J. S., Costello, A. J., ... & Corcoran, N. M. (2016). Reduction in expression of the benign AR transcriptome is a hallmark of localised prostate cancer progression. Oncotarget, 7(21), 31384. • Sapre, N., Macintyre, G., Clarkson, M., Naeem, H., Cmero, M., Kowalczyk, A., ... & Hovens, C. M. (2016). A urinary microRNA signature can predict the presence of bladder urothelial carcinoma in patients undergoing surveillance. British journal of cancer, 114(4), 454-462. • 2015 • Johanson, T. M., Keown, A. A., Cmero, M., Yeo, J. H., Kumar, A., Lew, A. M., ... & Chong, M. M. (2015). Drosha controls dendritic cell development by cleaving messenger RNAs encoding inhibitors of myelopoiesis. Nature immunology, 16(11), 1134-1141. • Hong, Matthew K.H., et al. [author 9 of 29] (2015). Tracking the origins and drivers of subclonal metastatic expansion in prostate cancer." Nature communications 6 • 2014 • Johanson, T. M., Cmero, M., Wettenhall, J., Lew, A. M., Zhan, Y., & Chong, M. M. (2014). A microRNA expression atlas of mouse dendritic cell development. Immunology and Cell Biology. • Schroeder, J., Hsu, A., Boyle, S. E., Macintyre, G., Cmero, M., Tothill, R. W. & Papenfuss, A. T. (2014). Socrates: identification of genomic rearrangements in tumour genomes by re-aligning soft clipped reads. Bioinformatics, btt767.