Upgrade to Pro — share decks privately, control downloads, hide ads and more …

RNA-seq read alignment to individualized genomes

Sponsored · Your Podcast. Everywhere. Effortlessly. Share. Educate. Inspire. Entertain. You do you. We'll handle the rest.
Avatar for Steve Munger Steve Munger
January 21, 2015
210

RNA-seq read alignment to individualized genomes

WebEx Journal Club discussing Munger et al. 2014 Genetics article with Duke Molecular Physiology Institute NGS interest group. 1/21/2015

Avatar for Steve Munger

Steve Munger

January 21, 2015

More Decks by Steve Munger

Transcript

  1. RNA-­‐seq  alignment  to   individualized  genomes.   Steve  Munger  

    @stevemunger     Post-­‐doctoral  Fellow   Gary  Churchill  Group   The  Jackson  Laboratory   Bar  Harbor,  Maine  USA     Duke  Molecular  Physiology  InsNtute   NGS  Interest  Group   Slides  are  posted  on  www.speakerdeck.com/stevemunger  
  2. Alignment  101                

     ACATGCTGCGGA   ACATGCTGCGGA   100bp  Read   Chr  1   Chr  2   Chr  3  
  3. The  perfect  read:  1  read  =  1  unique  alignment.  

                   ACATGCTGCGGA   ACATGCTGCGGA   100bp  Read   ✓   Chr  1   Chr  2   Chr  3  
  4. Some  reads  will  align  equally  well  to  mulNple   locaNons.

     “MulNreads”                ACATGCTGCGGA                  ACATGCTGCGGA                                                        ACATGCTGCGGA   ACATGCTGCGGA   100bp  Read   ✓   ✗   ✗   1  read   3  valid  alignments   Only  1  alignment  is  correct  
  5. The  worst  case  scenario.            

       ACATGCTGCGGA                  ACATGCTGCGGC                                                        ACATGCTGCGGA   ACATGCTGCGGA   100bp  Read   ✗   ✗   1  read   2  valid  alignments   Neither  is  correct  
  6. Individual  geneNc  variaNon  may  affect  read   alignment.    

               ACATGCTGCGGA                  ACATGCTGCGGC                                                        ACATGCTGCGGA   ATATGCTGCGGA   100bp  Read   ✗   ✗  
  7.  Aligning  Billions  of  Short  Sequence  Reads   Gene  A  

    Gene  B   Aligners:  BowNe,  GSNAP,  BWA,  MAQ,  BLAT   +  100  more   Designed  to  align  the  short  reads  fast,  but  not  accurate    
  8. Gene  A   Gene  B   •     Gene  family

     (orthologous/paralogous)   •     Low-­‐complexity  sequence   •     AlternaNvely  spliced  isoforms     •     Pseudogenes    Aligning  Sequence  Reads   •     Polymorphisms   •     Indels   •     Structural  Variants   •     Reference  sequence  Errors  
  9. Exon  2   Exon  3   Exon  1   Aligning

     to  Reference  Genome:  Exon  First  Alignment  
  10. Exon  2   Exon  3   Exon  1   Aligning

     to  Reference  Genome:  Exon  First  Alignment  
  11. Exon  2   Exon  3   Exon  1   Aligning

     to  Reference  Genome:  Exon  First  Alignment  
  12. Exon  2   Exon  3   Exon  1    Exon

     First  Alignment:  Pseudogene  problem   Exon  2   Exon  3   Exon  1   Processed  Pseudo-­‐gene  
  13. Exon  2   Exon  3   Exon  1    Exon

     First  Alignment:  Pseudogene  problem   Exon  2   Exon  3   Exon  1   Processed  Pseudo-­‐gene  
  14. Exon  2   Exon  3   Exon  1    Exon

     First  Alignment:  Pseudogene  problem   Exon  2   Exon  3   Exon  1   Processed  Pseudo-­‐gene  
  15. Align  to  Genome  or  Transcriptome?   Genome   Transcriptome  

    Advantages:  Can  align  novel  isoforms.   Disadvantages:    Difficult,  Spurious  alignments,  spliced  alignment,  gene  families,  pseudogenes  
  16. Exon  2   Exon  3   Exon  1   Isoform

     1   Isoform  2   Isoform  3   Reference  Transcriptome     Gene  1   Exon  2   Exon  3   Exon  1   Isoform  1   Isoform  2   Isoform  3   Gene  2   Exon  4  
  17. Align  to  Genome  or  Transcriptome?   Genome   Transcriptome  

    Advantages:    Easy,  Focused  to  the  part  of  the  genome  that  is  known  to  be  transcribed.   Disadvantages:    Reads  that  come  from  novel  isoforms  may  not  align  at  all  or  may  be        misafributed  to  a  known  isoform.   Advantages:  Can  align  novel  isoforms.   Disadvantages:    Difficult,  Spurious  alignments,  spliced  alignment,  gene  families,  pseudo  genes  
  18. Befer  Approach:  Aligning  to  Transcriptome  and  Genome   Align  to

     Transcriptome  First   Advantages:    relaNvely  simpler,  overcomes  the  pseudo-­‐gene  and   novel  isoform  problems   Align  the  remaining  reads  to  Genome  next   RUM,  TopHat2,  STAR  
  19. Conclusions   •  There  is  no  perfect  aligner.  Pick  one

     well-­‐suited  to  your   applicaNon.   –  E.g.  Want  to  idenNfy  novel  exons?  Don’t  align  only  to  the  known   set  of  isoforms.   •  Visually  inspect  the  resulNng  alignments.  Seing  a   parameter  a  lifle  too  liberal  or  conservaNve  can  have  a   huge  effect  on  alignment.   •  Consider  running  the  same  fastq  files  through  mulNple   alignment  pipelines  specific  to  each  applicaNon.   –  Gene  expression  -­‐>  BowNe  to  transcriptome     –  Exon  discovery  -­‐>  RUM  or  other  hybrid  mapper   –  Variant  detecNon  -­‐>  GSNAP,  GATK,  Samtools  mpileup   •  If  your  species  has  not  been  sequenced,  use  a  de  novo   assembly  method.  Can  also  use  the  genome  of  a  related   species  as  a  scaffold.  
  20. 18M 18M 4M 4M 4M 4M 7M More  geneNc  diversity

     =     More  phenotypic  diversity  =     More  analyNcal  complexity   C57BL/6J Brynn  Voy  
  21. The  CollaboraNve  Cross:  A  large  panel  of  recombinant  inbred  

    lines  derived  from  eight  inbred  founder  strains.   CC001–  98%  Homozygous  
  22. The  Diversity  Outbred  (DO)  heterogeneous  stock.   Collaborative Cross Funnel

    Diversity Outbred … G2:F4-F12 mice from 144 different funnels Random Outbreeding
  23. The complex genomes of DO mice. A/J   A  

    BL6   B   129   C   NOD   D   NZO   E   CAST   F   PWK   G   WSB   H   1   2   3   4   5   6   7   8   9   10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36   A   A   A   A   A   A   A   A   B   B   B   B   B   B   B   C   C   C   C   C   C   D   D   D   D   D   E   E   E   E   F   F   F   G   G   H   A   B   C   D   E   F   G   H   B   C   D   E   F   G   H   C   D   E   F   G   H   D   E   F   G   H   E   F   G   H   F   G   H   G   H   H   36 Diplotype States 8 Founder Haplotypes
  24. Current  RNA-­‐seq  Analysis:  One  Common  Reference   Genome  and  Two

     Separate  Analysis  Pipelines       1)  One  Pipeline  for  quanNfying  gene  expression   •  For  example:  TopHat/Cufflinks     2)  Second  pipeline  for  allele-­‐specific  gene  expression   •  Using  single  reference  genome  and  known  SNPs    
  25. Based  on  known  gene  annotaNons,  we  expect  that   >50%

     of  100bp  CAST  reads  will  have  at  least  one  SNP   that  differs  from  the  reference.     Sanger  Mouse  Genomes  Project  
  26. 100bp  SE  Reads  from  CAST  liver   Compare  alignment  results

     to  ground  truth   Align  to  CAST  Pseudotranscriptome   5’-­‐ATCGGCGTCTTACATTAGCTCAAGGGTGCC-­‐3’   5’-­‐ATCGGCGTCTTGCTCAAGGGTGCC-­‐3’   Align  to  B6  Transcriptome   5’-­‐ATCGGCGTCTTACATTAGCTCAAGGGTGCC-­‐3’   To  what  degree  do  these  differences  affect  alignment  of  RNA-­‐Seq  reads   and  gene  abundance  esNmates?   Simulated  reads   Real  data  
  27. Simulated  CAST  reads  map  more  accurately  and   uniquely  to

     the  CAST  transcriptome.   458,297  out  of  ~10M  reads  improve  by  alignment  to  CAST   10,533  reads  improve  by  alignment  to  the  reference.  
  28. Gene-­‐level  abundance  esNmates  are  improved   by  alignment  to  CAST

     transcriptome.   RSEM,  Li  and  Dewey  2010  
  29. For  2,984  genes,  abundance  esNmates     differ  by  >

     10%  by  alignment  approach  alone.  
  30. For  these  genes  in  the  simulated  data,   2,242  –

     CAST  alignment  gave  befer  esNmate   439  –  REF  alignment  gave  befer  esNmate   71  –  CAST  esNmate  =  REF  esNmate   232  –  No  results  in  simulaNon   One  real  CAST  sample   2,984  genes  differ  by  >  10%  by  alignment  alone.      
  31. DO  genomes  are  diploid  with  28  possible  heterozygous  and  

    8  homozygous  genotype  states  at  every  locus.     A/J   A   BL6   B   129   C   NOD   D   NZO   E   CAST   F   PWK   G   WSB   H   1   2   3   4   5   6   7   8   9   10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36   A   A   A   A   A   A   A   A   B   B   B   B   B   B   B   C   C   C   C   C   C   D   D   D   D   D   E   E   E   E   F   F   F   G   G   H   A   B   C   D   E   F   G   H   B   C   D   E   F   G   H   C   D   E   F   G   H   D   E   F   G   H   E   F   G   H   F   G   H   G   H   H   Founder strains – 8 possible genotypes Diversity Outcross – 36 Possible Genotype states
  32. Building  an  individualized  diploid  transcriptome.   F   F  

    D   D   D   D   D   C   C   A   A   A   A   A   A   A   G   G   E   E   E   E   E   E   H   H   H   H   G   G   G   G   B   B   B   B   B   A   A   H   H   H   H   F   F   F   F   F   F   E   E   C   C   C   D   D   Psuedo-­‐phased   Chromosomes   Two  Haploid   Chromosomes   Genotype  DNA  @  8-­‐80k   informaNve  SNPs   FG   FG   DG   DG   DB   DB   DB   CB   CB   AA   AA   AH   AH   AH   AH   AF   GF   GF   EF   EF   EF   EE   EE   EC   HC   HC   HD   HD   Infer  36-­‐state   genotypes   Munger  et  al.,  2014   Gai  et  al.,  2014  
  33. Munger  et  al.  2014   Gai  et  al.  2014  

    ConstrucNng  individualized  diploid  transcriptomes  for     RNA-­‐seq  alignment  with  Seqnature.  
  34. Coming  soon  –     EMASE  (N.  Raghupathy)   POPULASE

     (KB  Choi)   Seqnature   Munger  et  al.  2014   Gai  et  al.  2014  
  35. Align  each  read  once  to  both  alleles.   CCTCAGGGTCAACTCTAAGGAAGT GATCAGGGTCAACTCTAAGGAAGT

    ENSMUST0000000001  E  L   ENSMUST0000000001  H  R   Transcript  ID        Founder  Strain  A-­‐H  (NZO)      Chr  side   AGGGTCAACTCTAAGG Read  1   AGGGTCAACTCTAAGG AGGGTCAACTCTAAGG ENSMUST0000000001  E  L   Count  weight  =  0.5   ENSMUST0000000001  H  R   Count  weight  =  0.5  
  36. Align  each  read  once  to  both  alleles.   CCTCAGGGTCAACTCTAAGGAAGT GATCAGGGTCAACTCTAAGGAAGT

    ENSMUST0000000001  E  L   ENSMUST0000000001  H  R   GATCAGGGTCAACTCT Read  1   GATCAGGGTCAACTCT ENSMUST0000000001  E  L   Count  weight  =  0   ENSMUST0000000001  H  R   Count  weight  =  1   Direct  output  of  allelic  abundance  esNmates  
  37. 100bp  SE  Reads  from  DO  liver   Compare  Results  

    Align  to  diploid  DO  transcriptome   5’-­‐ATCGGCGTCTTGCTCAAGGGTGCC-­‐3’               5’-­‐ATCGGCGTCTTGATCTTGGGTGCC-­‐3’   Align  to  REF  Transcriptome   5’-­‐ATCGGCGTCTTACATTAGCTCAAGGGTGCC-­‐3’   SimulaNons!   Simulated  reads   Real  data  
  38. Reads  map  more  accurately  and  uniquely  by   alignment  to

     DO  transcriptome.   Munger  et  al.  2014  
  39. For  714  genes,  abundance  esNmates     differ  by  >

     10%  by  alignment  approach  alone.  
  40. One  real  DO  sample   714  genes  differ  by  >

     10%  by  alignment  alone.       For  these  genes  in  the  simulated  data,   432  –  DO  alignment  gave  befer  esNmate   124  –  REF  alignment  gave  befer  esNmate   16  –  DO  esNmate  =  REF  esNmate   142  –  No  results  in  simulaNon  
  41. Every  DO  sample  will  have  a  unique  gene  set  that

     is  sensiNve   to  alignment  errors  from  reference  alignment…  
  42. Does  this  mafer  to  humans?   Gene  expression  from  

    Individualized  Genome   Gene  expression  from       Reference  Genome   Narayanan  Raghupathy  
  43. Individualized  RNA-­‐seq  analysis  in  50  African   Individuals   Gene

     expression  from   Individualized  Genome   Gene  expression  from       Reference  Genome  
  44. High  Fat   Chow   Diversity  Outbred  Mice    

    GeneraNons  G4-­‐G8   ~200-­‐300  recombinaNons   wean   Phenotyping   Livers   Livers   Livers   Livers   N=  73   N=  70   N=  68   N=  66   Sac  @  26  weeks  
  45. Analysis  Pipeline   ~  30  million  SE  100bp  reads  

    Yfg   1.  Align  reads  to  transcriptome.   Yfg   Yfg   Yfg   Mouse  1   Mouse  2   Mouse  3   x  272  mice   RSEM  (Li  and  Dewey  2010)   2.  EsNmate  gene  and  isoform  expression.   3.  Map  expression  QTL  
  46. How  does  individualized  alignment  affect  eQTL?   Yfg   Yfg

      Yfg   Mouse  1   Mouse  2   Mouse  3   x  453mice    EsNmate  gene  and  isoform  expression.   3.  Map  expression  QTL  
  47. Alignment  to  individualized  transcriptomes  results   in  fewer  spurious  liver

     eQTL.   Rps12-ps2 Aligned to NCBIm37 Aligned to DO IRGs
  48. Hebp1 Aligned to NCBIM37 Aligned to DO IRGs Alignment  to

     individualized  transcriptomes   reveals  significant  local  eQTLs  for  2,000+  genes.  
  49. Munger  et  al.  2014   Are  these  unmasked  local  eQTLs

     real?   CC/DO  Founder  Strain  samples  
  50. The  founder  origin  of  each  allele  is  tagged  and  provides

     direct   esNmates  of  allele  specific  expression.   The  local  eQTL  for  Gm12976  is  cis-­‐acNng.   DO  samples  N=277   N=554  allele-­‐specific  esNmates.  
  51. Goal:  Make  data  accessible  and  useful.   Example:  Dynamic  eQTL

     Viewer.     hfp://cgd.jax.org/apps/eqtlviewer-­‐beta/   Karl  Broman        hfp://kbroman.github.io/qtlcharts/  
  52. Summary:  Tools  to  embrace  geneNc  diversity  in  RNA-­‐ seq  analysis

      •   Seqnature:  Building  personal  diploid  genomes  using  known   geneNc  variaNon.  Can  be  applied  to  human  data.   •   EMASE:  Accurate  and  simultaneous  quanNtaNon  of  gene   expression  and  allele-­‐specific  expression   •   Diversity  Outbred  mice  are  ideal  for  high-­‐resoluNon  mapping  of   expression  QTL.  r/DOQTL:  comprehensive  DO  analysis  tools.   •   We  have  developed  methodology  for  dealing  with  exploiGng  the   high  geneNc  diversity  in  this  populaNon.  
  53. •   ApplicaNons     •   Human  data  -­‐  HapMap  african

     populaNon  genomics.   •   SEG-­‐Pas  mouse  spleen  infected  with  Y.  pes*s  –  IdenNfy  reads  of   bacterial  origin.     •   PaNent  Derived  Xenogra}s  –  Parse  gra}  v  host-­‐derived  RNA.     •   ChIP-­‐seq  in  F1  or  HS  mice  –  Characterize  allele-­‐specific  binding.   •   Bulk  Segregant  Analysis  of  pooled  RNA-­‐seq  –  Map  mutaNons/  QTL.   Summary:      Tools  to  Embrace  GeneNc  Diversity  in   RNA-­‐seq  Analysis  
  54. Thank  you!   •  DOQTL  -­‐  hfp://cgd.jax.org/apps/doqtl/DOQTL.shtml   •  Seqnature

     -­‐  hfp://cgd.jax.org/tools/Seqnature.shtml   •  EMASE  –  Coming  Soon!   •  eQTL  Viewer  -­‐  hfp://cgd.jax.org/apps/eqtlviewer-­‐beta/   •  AieWeb  (DO  founder  expression  viewer)   –  hfp://cgd.jax.org/aie/rnaseq/   •  Sanger  Mouse  Genomes  Project  (Keane  and  others)   –  hfp://www.sanger.ac.uk/sanger/Mouse_SnpViewer/rel-­‐1303   •  r/qtlcharts  (K  Broman)  -­‐  hfp://kbroman.github.io/qtlcharts/  
  55. Resources   Individualized  Genomes      -­‐    Seqnature  

     hfps://github.com/jaxcs/Seqnature   Aligner   –  BowGe    hfp://bowNe-­‐bio.sourceforge.net/   –  BowNe  2  hfp://bowNe-­‐bio.sourceforge.net/bowNe2/index.shtml   –  GSNAP  hfp://research-­‐pub.gene.com/gmap/     –  Tophat  hfp://tophat.cbcb.umd.edu/   –  STAR  hfps://code.google.com/p/rna-­‐star/   Transcript  Abundance  /  DifferenNal  Expression   –  Cufflinks  hfp://cufflinks.cbcb.umd.edu/   –  IsoEM  hfp://dna.engr.uconn.edu/?page_id=105   –  RSEM  hfp://deweylab.biostat.wisc.edu/rsem/   –  EMASE  (Coming  Soon!)   –  Miso  hfp://genes.mit.edu/burgelab/miso/     –  Cuffdiff  hfp://cufflinks.cbcb.umd.edu/   –  DESeq  hfp://www-­‐huber.embl.de/users/anders/DESeq/   –  edgeR  hfp://bioconductor.org/packages/release/bioc/html/edgeR.html   Denovo  Assembly   –  Trinity  hfp://trinityrnaseq.sourceforge.net/  
  56. DO  allele  esNmates  in  genes  with  local  eQTL   strong

     correlated  to  gene  esNmates  from  the   Founder  strains.   Genes  with  local  eQTL   Genes  without  local  eQTL