Specialist or Generalist: messages from caterpillars

Specialist or Generalist: messages from caterpillars

59b13b63d5686c3ca1e00034af6089c9?s=128

Tomokazu_Abe

May 05, 2020
Tweet

Transcript

  1. None
  2. ⚫ ⚫ ⚫ ⚫ • • •

  3. • • • • • •

  4. None
  5. None
  6. None
  7. None
  8. ☠ • •

  9. None
  10. None
  11. None
  12. None
  13. None
  14. None
  15. cggttgcgcagcttcctattaaaccatcaaacttagcgt ccgcgatatagcaacggccctcattcgccgccttagc gccttgatcgctacgcgtctgccgtcggcgaattgagt aacaacatggtagtgggctatgtcacatgctcacgtg ccctcctacatgtctttaagaagttattccatggcttacc caaacgtcgctcgataaattcatgtctaattcactccgc acgatgacgctcgatagacatggcatggatcagatta ccctacgcacgttcaacaattgtaggttccgcgggag cgggccggcccggtagctacatccccccccctcgatt ctcctattacgcatggtcgcgttagggaacgcgtcagc

    cggccctgctccccttaagcgtctagggatcaggcac gatcggaggaaaagcgatgcctttgataaagttccaa aagtatacgggcccagtgaacagtgacgatttccgtg acagtacagg
  16. None
  17. None
  18. None
  19. None