Kamil S. Jaron polyploidy webinar

Transcript

1. Characterising features of polyploid genomes directly from sequencing reads Kamil S. Jaron @KamilSJaron April 20, 2020 1
2. Genome assembly is difficult! 2
3. Assembly errors diploid genome duplication heterozygous region sequencing genome assembly separatelly assembled alleles collapsed paralogs 3
4. Genome assembly is even more difficult for polyploids! More prior information the better! 4
5. Non-sequencing techniques genome size estimate via flow cytometry ploidy via karyotype staining Gutekunst et al. 2018 Schwander & Crespi 2009 5
6. Features from raw sequencing reads An individual genome genome size repetitivness transposable element loads heterozygosity ploidy Population genomics divergence of two individuals GWAS references in supplementary slides 6
7. Kmer spectra analysis decomposition of reads to all consecutive kmers read kmers (k = 7) ATCTAAACGATCGATCGATCGA ATCTAAA TCTAAAC CTAAACG TAAACGA ... 7
8. Reads to kmers 8
9. Kmer coverage kmer coverage AAAAAAAAAACAACGT 28 AAAAATAACACAACGT 31 AAAAATAACACAACGG 1 AAAAATAACGCAACGT 47 AAAATTTACGCAACGT 2 AAAATTTACGCAACGA 17 ... ... 9
10. kmer spectrum of an homozygous genome 10
11. kmer spectrum of an heterozygous genome 11
12. GenomeScope: given kmer spectra, what is... 1n coverage the genome length heterozygosity repetitivness (% of the genome that is unique) Vurture et al. 2017 12
13. GenomeScope 2.0 given ploidy, for up to hexaploids ... Rhyker Ranallo-Benavidez 13
14. kmer spectrum of a triploid genome Homozygous: Heterozygous: 3n 1n + 2n 3 x1n 3n 2n 1n genomic copies 14
15. Model fit to the triploid genome 15
16. kmer spectrum of a polyploid genome 16
17. Is there more information in the kmer spectra to utilise? Every heterozygous kmers has the sister kmers sequenced as well. 17
19. Search for kmer pairs! kmers that are different in a single SNP kmers that form a unique pair 19
20. Kmer pairs kmer coverage AAAAA 128 AAAAT 41 AAAAC 57 AAATT 31 AAATA 38 AAACG 67 ... ... 20
21. The idea kmer pairs are mostly two alleles of the same locus. 21
22. Two informative transformations : covA + covB ≈ number of genomic copies covB / (covA + covB) ≈ proportion of the kmers of the less represented allele 22
23. structure A + B B / (A + B) AB 200 0.5 AAB 300 0.33 AABB 400 0.5 AAAB 400 0.25 AAAAB 500 0.2 ... ... ... 1n coverage = 100 23
25. Tetraploid root-knot nematode smudgeplot 25
26. Combined GenomeScope/Smudgeplot interpretation AB AABB AAAB AAB 26
27. Applications 27
28. the mystery of Meladogyne floridensis a diploid among polyploids 28
29. the mystery of Meladogyne floridensis 29
32. What about theoretically homozygous genomes? 32
33. A heterozygosity after gamete duplication? 33
34. A heterozygosity after gamete duplication? 34
35. No heterozygosity ⇒ we plot the paralog structure 35
37. Octoploid strawberry smudgeplot! 37
38. Main pitfall: duplications >> heterozygosity A diploid strawberry estimated as tetraploid. 38
39. Considerations 39
40. GenomeScope assumptions: uniform distribution of heterozygous loci and duplications the coverage estimate is right heterozygosity is ”reasonable” (< 12%) GenomeScope strengths: negligible computational time, scales to any dataset Works for any coverage the allows a fit of the model Unbelivebly accurate genome size estimate* *There are conditions to it, check the resources in the supplement 40
41. GenomeScope assumptions: uniform distribution of heterozygous loci and duplications the coverage estimate is right heterozygosity is ”reasonable” (< 12%) GenomeScope strengths: negligible computational time, scales to any dataset Works for any coverage the allows a fit of the model Unbelivebly accurate genome size estimate* *There are conditions to it, check the resources in the supplement 40
42. Smudgeplot assumptions: heterozygosity >> pralogy only single genome with decent coverage computationally it’s still rather exhaustive (Biggest so far 3.5Gbp triploid; sorry plant people :-/) Smudgeplot strengths: Strong descriptive visualization technique especially paired up with GenomeScope 2.0 Decent 1n estimate 41
43. Smudgeplot assumptions: heterozygosity >> pralogy only single genome with decent coverage computationally it’s still rather exhaustive (Biggest so far 3.5Gbp triploid; sorry plant people :-/) Smudgeplot strengths: Strong descriptive visualization technique especially paired up with GenomeScope 2.0 Decent 1n estimate 41
44. Genome assembly is still useful but it’s good to have a big scale picture before anything as complicated as genome assembly. Do you have a weird genome to share? https://kamilsjaron.github.io/ peculiar-genomic-observations/ 42
45. Genome assembly is still useful but it’s good to have a big scale picture before anything as complicated as genome assembly. Do you have a weird genome to share? https://kamilsjaron.github.io/ peculiar-genomic-observations/ 42
46. A big shout-out to my collaborators! Rhyker Ranallo-Benavidez Michael Schatz 43
47. Resources Kmer methods GenomeScope 2.0 https://github.com/tbenavi1/genomescope2.0 Smudgeplot https://github.com/KamilSJaron/smudgeplot KMC really fast kmer counter https://github.com/refresh-bio/KMC KAT versatile kmer analysis tools; especially useful to make sense of kmer spectra and genome assembly https://github.com/TGAC/KAT kmer GWAS papers: https://doi.org/10.1038/s41588-020-0612-7, https://doi.org/10.1101/2020.04.14.040675 Other kmer resources Zen and the art of k-mers Good kmer introduction https://dib-lab.github.io/zen-khmer/index.html Peculiar genomics cases A colleciton of strange observations in genomics https://kamilsjaron.github.io/peculiar-genomic-observations/ Genome size estimate considerations: Benchmarking of flow cytometry and kmer based methods using Rooibos genome by Mgwatyu et al. 2020 https://doi.org/10.3390/plants9020270; A peculiar case of marbled crayfish genome size: https://kamilsjaron.github.io/peculiar-genomic-observations/biological/2020/01/crayfish.html More details about the strawberry case: https://github.com/KamilSJaron/smudgeplot/wiki/strawberry-tutorial 44
48. References Vurture, Gregory W., et al. GenomeScope: fast reference-free genome profiling from short reads. Bioinformatics 33.14 (2017): 2202-2204. Ranallo-Benavidez, T.R., Jaron, K.S. & Schatz, M.C. GenomeScope 2.0 and Smudgeplot for reference-free profiling of polyploid genomes. Nat Commun 11, 1432 (2020). https://doi.org/10.1038/s41467-020-14998-3 karyotype from Schwander, T., & Crespi, B. J. (2009). Multiple direct transitions from sexual reproduction to apomictic parthenogenesis in Timema stick insects. Evolution: International Journal of Organic Evolution, 63(1), 84-103. flow cytometry picture from Gutekunst, J., Andriantsoa, R., Falckenhayn, C., Hanna, K., Stein, W., Rasamy, J., & Lyko, F. (2018). Clonal genome evolution and rapid invasive spread of the marbled crayfish. Nature ecology & evolution, 2(3), 567. sequencing errors in kmers pic from https://dib-lab.github.io/zen-khmer/manipulating-histograms.html root knot phylogeny from Lunt, D. H., Kumar, S., Koutsovoulos, G., & Blaxter, M. L. (2014). The complex hybrid origins of the root knot nematodes revealed through comparative genomics. PeerJ, 2, e356. 45
49. Thank you for your attention! 46