Transcriptional plasticity in the hippocampus and its role in avoidance learning

Slides from my thesis defense talk.

Transcript

1. Transcriptional plasticity in the hippocampus and its role in avoidance learning Rayna M. Harris Thesis Defense October 18, 2017 1
2. 2 How do we learn the best and worst ways to navigate around Austin?
3. 3 How do we decide when to take a different route?
4. Learning, memory, and decision-making are controlled by multiple levels of biological organization 4
5. The hippocampus is critical for remembering relationships in space and time 5 Hippocampus is the Greek word for Seahorse
6. Spatial information flows through awesome neurons in the hippocampal circuit 6 Weissman, Lichtman & Sanes, 2005 Ramón y Cajal 1911
7. RNA sequencing allows us to measure the molecular response to learning 7 TCAGAATTTCTCAACGGTTCGAGATGGAAAGCAGCTTACGCCAGAGAGAGACTCCTCGAAACGTGTTCTG ACAGGATGCTTTCTCTCCCTGCTCATCTTCACCACGCTGCTAGGCAACACCCTGGTGTGCGCTGCCGTCA CCAAGTTCCGACACCTGAGGTCGAAGGTCACCAATTTCTTTGTCATCTCGCTGGCCATCTCTGACCTCCT GGTAGCTATTTTGGTAATGCCATGGAAGGCAGCGACAGAGATTGTGGGGTTTTGGCCGTTTGGTGCATTC TGCAACGTGTGGGTGGCATTTGACATAATGTGCTCCACTGCCTCCATCTTGAACTTGTGTGTGATTAGTG TCGATCGTTACTGGGCCATTTCAAGCCCATTCCGCTATGAACGCAAGATGACCCCTAAAGTAGCGTGTCT GATGATCAGTGTGGCATGGACCTTGTCTGTCCTCATCTCCTTCATTCCTGTTCAGCTTAACTGGCACAAA GCTCAGACCACCAGCTATGTCGAGCTAAATGGAACCTACCCTGATGATTTGCCCCCTGACAACTGTGACT TCAGTCTTAACAGGACCTATGCCATCTCCTCCTCCCTTATCAGCTTCTACATCCCCGTGGCAATTATGAT CGTCACTACACCCGGATCTACCGCATCGCCCAGACACAGATAAGGAGAATATCTGCTTTGGAGCGAGCA GCAGAGAGTGCCAAAAACCGACACAGCAGCATGGGAAACAGTTCAAACATGGACAGTGAGAGCTCATTTA AAATGTCATTCAAAAGAGAAACCAAAGTCTTAAAGACGCTCTCTGTCATAATGGGCGTGTTCGTGTGCTG CTGGTTGCCCTTCTTCATCCTAAACTGCATGGTTCCATTCTGTGAAACACACATGCCAGATGGATCCACA GAATTCCCCTGCATCAGCTCCACCACCTTTGATGTGTTTGTGTGGTTTGGCTGGGCAAACTCTTCGCTCA
8. Outline of my thesis research 8
9. Outline of my thesis research 1. How does conditioned place avoidance learning alter transcription in the hippocampal circuit? 8
10. Outline of my thesis research 1. How does conditioned place avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 8 Phenotypes Transcriptomics Genetic Manipulation Genes
11. Outline of my thesis research 1. How does conditioned place avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 8 Harris et al. 2017 BioRxiv https://github.com/raynamharris/DissociationTest/ Phenotypes Transcriptomics Genetic Manipulation Genes
12. A 5 year collaboration in conjunction with the Neural Systems & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
13. A 5 year collaboration in conjunction with the Neural Systems & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
14. We built a a collaborative laboratory space every summer specifically for this project 10
15. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning A mouse in the Active Place Avoidance arena
16. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning A mouse in the Active Place Avoidance arena
17. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning A mouse in the Active Place Avoidance arena Carousel in Paris analogy
18. Consistently trained, conflict trained, and yoked control groups 12
19. Consistently trained, conflict trained, and yoked control groups 12 Yoked and trained mice are simultaneously shocked when the trained mouse enters the shock zone
20. Consistently trained, conflict trained, and yoked control groups 12 Yoked and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not
21. Consistently trained, conflict trained, and yoked control groups 12 Yoked and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not Conflict mice have to learn a new spatial association and override an old one
22. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/
23. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session A B C
24. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session * * * A B C
25. Additional behavioral measures illustrate that trained animals avoid the shock zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
26. Additional behavioral measures illustrate that trained animals avoid the shock zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
27. Research questions 15 vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
28. Research questions 15 vs. vs. vs. vs. 1. How does avoidance learning change gene expression in the hippocampus? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
29. Research questions 15 vs. vs. vs. vs. 1. How does avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
30. Research questions 15 vs. vs. vs. vs. 1. How does avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? 3. Does receiving more shocks have an effect on the brain? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
31. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
32. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
33. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
34. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
35. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
36. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16
37. Tissue source explains the most variation across samples 17 https://github.com/raynamharris/IntegrativeProjectWT2015/ Tissue samples from all 7 experimental groups
38. Tissue source explains the most variation across samples 17 https://github.com/raynamharris/IntegrativeProjectWT2015/ Tissue samples from all 7 experimental groups
39. 18 https://github.com/raynamharris/IntegrativeProjectWT2015/ Volcano plots show fold-change difference and significance for all genes Log Fold Change
40. 18 https://github.com/raynamharris/IntegrativeProjectWT2015/ Volcano plots show fold-change difference and significance for all genes Log Fold Change Log Fold Change Log Fold Change
41. ~100 Genes in DG are unregulated in response to consistent cognitive training 19 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
42. Genes encoding transcription factors are up-regulated in DG in response to training 20 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
43. Is this transcriptional activation related to neurogenesis and/or memory storage in the DG? 21 Sapolsky 2004 Frankland lab
44. The CA1 response to both cognitive training and stressors 22 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
45. Cognitive training activates ion channel signaling and membrane transport 23 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
46. Additional stressors also activate ion channel signaling and membrane transport 24 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
47. The classic molecular signaling cascade for learning also responds to stress 25 Ebert & Greenberg Nature 2013 Learning Stress Ebert & Greenberg 2013
48. Slightly outta reach goal - identify genes that can increase or decrease learning 26 https://github.com/raynamharris/IntegrativeProjectWT2015/
49. Chapter 2 1. How does conditioned place avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 27 Phenotypes Transcriptomics Genetic Manipulation Genes
50. Genotype to phenotype mapping 28
51. Genotype to phenotype mapping 28 Phenotypes Transcriptomics Genetic Manipulation Genes
52. Genotype to phenotype mapping 29 Phenotypes Transcriptomics Genetic Manipulation Genes Behavior Transcriptomics Genetic Manipulation FMR1
53. Genotype to phenotype mapping 30 Phenotypes Transcriptomics Genetic Manipulation Genes Behavior Transcriptomics Genetic Manipulation FMR1 Ebert & Greenberg Nature 2013
54. FMR1 knock down has subtle effects on conditioned avoidance learning 31 https://github.com/raynamharris/FMR1CA1rnaseq
55. FMR1 knock down has subtle effects on conditioned avoidance learning 31 https://github.com/raynamharris/FMR1CA1rnaseq
56. FMR1 knock down has subtle effects on CA1 gene expression in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
57. FMR1 knock down has subtle effects on CA1 gene expression in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
58. FMR1 knock down has subtle effects on CA1 gene expression in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
59. 33 Summary of my thesis research
60. 33 I investigated learning at the molecular, neural, and behavioral levels Summary of my thesis research
61. 33 I investigated learning at the molecular, neural, and behavioral levels I created an open and reproducible analysis workflow Summary of my thesis research
62. 33 I investigated learning at the molecular, neural, and behavioral levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Summary of my thesis research
63. 33 I investigated learning at the molecular, neural, and behavioral levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Transcription in the hippocampus is both plastic and robust Summary of my thesis research
64. Things I’ve learned 34
65. Things I’ve learned • Learning is hard to evaluate 34
66. Things I’ve learned • Learning is hard to evaluate • Big, complex behavioral datasets can be summarized and interpreted 34
67. Things I’ve learned • Learning is hard to evaluate • Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific 34
68. Things I’ve learned • Learning is hard to evaluate • Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific • Genomic sequencing can’t provide the answer for all biological questions 34
69. 35 There is still so much to learn about learning, memory, and decision making
70. Open and collaborative science is awesome! 36
71. Open and collaborative science is awesome! • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
72. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
73. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
74. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
75. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
76. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
77. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
78. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
79. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
80. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
81. Open and collaborative science is awesome! • My advisor, Hans Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36