Transcriptional plasticity in the hippocampus and its role in avoidance learning

359f7070cb587948e7da4e1028f5fc41?s=47 Rayna M Harris
December 18, 2017

Transcriptional plasticity in the hippocampus and its role in avoidance learning

Slides from my thesis defense talk.

359f7070cb587948e7da4e1028f5fc41?s=128

Rayna M Harris

December 18, 2017
Tweet

Transcript

  1. Transcriptional plasticity in the hippocampus and its role in avoidance

    learning Rayna M. Harris Thesis Defense October 18, 2017 1
  2. 2 How do we learn the best and worst ways

    to navigate around Austin?
  3. 3 How do we decide when to take a different

    route?
  4. Learning, memory, and decision-making are controlled by multiple levels of

    biological organization 4
  5. The hippocampus is critical for remembering relationships in space and

    time 5 Hippocampus is the Greek word for Seahorse
  6. Spatial information flows through awesome neurons in the hippocampal circuit

    6 Weissman, Lichtman & Sanes, 2005 Ramón y Cajal 1911
  7. RNA sequencing allows us to measure the molecular response to

    learning 7 TCAGAATTTCTCAACGGTTCGAGATGGAAAGCAGCTTACGCCAGAGAGAGACTCCTCGAAACGTGTTCTG ACAGGATGCTTTCTCTCCCTGCTCATCTTCACCACGCTGCTAGGCAACACCCTGGTGTGCGCTGCCGTCA CCAAGTTCCGACACCTGAGGTCGAAGGTCACCAATTTCTTTGTCATCTCGCTGGCCATCTCTGACCTCCT GGTAGCTATTTTGGTAATGCCATGGAAGGCAGCGACAGAGATTGTGGGGTTTTGGCCGTTTGGTGCATTC TGCAACGTGTGGGTGGCATTTGACATAATGTGCTCCACTGCCTCCATCTTGAACTTGTGTGTGATTAGTG TCGATCGTTACTGGGCCATTTCAAGCCCATTCCGCTATGAACGCAAGATGACCCCTAAAGTAGCGTGTCT GATGATCAGTGTGGCATGGACCTTGTCTGTCCTCATCTCCTTCATTCCTGTTCAGCTTAACTGGCACAAA GCTCAGACCACCAGCTATGTCGAGCTAAATGGAACCTACCCTGATGATTTGCCCCCTGACAACTGTGACT TCAGTCTTAACAGGACCTATGCCATCTCCTCCTCCCTTATCAGCTTCTACATCCCCGTGGCAATTATGAT CGTCACTACACCCGGATCTACCGCATCGCCCAGACACAGATAAGGAGAATATCTGCTTTGGAGCGAGCA GCAGAGAGTGCCAAAAACCGACACAGCAGCATGGGAAACAGTTCAAACATGGACAGTGAGAGCTCATTTA AAATGTCATTCAAAAGAGAAACCAAAGTCTTAAAGACGCTCTCTGTCATAATGGGCGTGTTCGTGTGCTG CTGGTTGCCCTTCTTCATCCTAAACTGCATGGTTCCATTCTGTGAAACACACATGCCAGATGGATCCACA GAATTCCCCTGCATCAGCTCCACCACCTTTGATGTGTTTGTGTGGTTTGGCTGGGCAAACTCTTCGCTCA
  8. Outline of my thesis research 8

  9. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 8
  10. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 8 Phenotypes Transcriptomics Genetic Manipulation Genes
  11. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 8 Harris et al. 2017 BioRxiv https://github.com/raynamharris/DissociationTest/ Phenotypes Transcriptomics Genetic Manipulation Genes
  12. A 5 year collaboration in conjunction with the Neural Systems

    & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
  13. A 5 year collaboration in conjunction with the Neural Systems

    & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
  14. We built a a collaborative laboratory space every summer specifically

    for this project 10
  15. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning

    A mouse in the Active Place Avoidance arena
  16. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning

    A mouse in the Active Place Avoidance arena
  17. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning

    A mouse in the Active Place Avoidance arena Carousel in Paris analogy
  18. Consistently trained, conflict trained, and yoked control groups 12

  19. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone
  20. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not
  21. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not Conflict mice have to learn a new spatial association and override an old one
  22. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/

  23. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session A B C
  24. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session * * * A B C
  25. Additional behavioral measures illustrate that trained animals avoid the shock

    zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
  26. Additional behavioral measures illustrate that trained animals avoid the shock

    zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
  27. Research questions 15 vs. vs. vs. vs. vs. vs. vs.

    vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  28. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  29. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  30. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? 3. Does receiving more shocks have an effect on the brain? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  31. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  32. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  33. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  34. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  35. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  36. My open and reproducible workflow https://github.com/raynamharris/IntegrativeProjectWT2015/ 16

  37. Tissue source explains the most variation across samples 17 https://github.com/raynamharris/IntegrativeProjectWT2015/

    Tissue samples from all 7 experimental groups
  38. Tissue source explains the most variation across samples 17 https://github.com/raynamharris/IntegrativeProjectWT2015/

    Tissue samples from all 7 experimental groups
  39. 18 https://github.com/raynamharris/IntegrativeProjectWT2015/ Volcano plots show fold-change difference and significance for

    all genes Log Fold Change
  40. 18 https://github.com/raynamharris/IntegrativeProjectWT2015/ Volcano plots show fold-change difference and significance for

    all genes Log Fold Change Log Fold Change Log Fold Change
  41. ~100 Genes in DG are unregulated in response to consistent

    cognitive training 19 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  42. Genes encoding transcription factors are up-regulated in DG in response

    to training 20 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  43. Is this transcriptional activation related to neurogenesis and/or memory storage

    in the DG? 21 Sapolsky 2004 Frankland lab
  44. The CA1 response to both cognitive training and stressors 22

    https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  45. Cognitive training activates ion channel signaling and membrane transport 23

    https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  46. Additional stressors also activate ion channel signaling and membrane transport

    24 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  47. The classic molecular signaling cascade for learning also responds to

    stress 25 Ebert & Greenberg Nature 2013 Learning Stress Ebert & Greenberg 2013
  48. Slightly outta reach goal - identify genes that can increase

    or decrease learning 26 https://github.com/raynamharris/IntegrativeProjectWT2015/
  49. Chapter 2 1. How does conditioned place avoidance learning alter

    transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 27 Phenotypes Transcriptomics Genetic Manipulation Genes
  50. Genotype to phenotype mapping 28

  51. Genotype to phenotype mapping 28 Phenotypes Transcriptomics Genetic Manipulation Genes

  52. Genotype to phenotype mapping 29 Phenotypes Transcriptomics Genetic Manipulation Genes

    Behavior Transcriptomics Genetic Manipulation FMR1
  53. Genotype to phenotype mapping 30 Phenotypes Transcriptomics Genetic Manipulation Genes

    Behavior Transcriptomics Genetic Manipulation FMR1 Ebert & Greenberg Nature 2013
  54. FMR1 knock down has subtle effects on conditioned avoidance learning

    31 https://github.com/raynamharris/FMR1CA1rnaseq
  55. FMR1 knock down has subtle effects on conditioned avoidance learning

    31 https://github.com/raynamharris/FMR1CA1rnaseq
  56. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  57. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  58. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  59. 33 Summary of my thesis research

  60. 33 I investigated learning at the molecular, neural, and behavioral

    levels Summary of my thesis research
  61. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow Summary of my thesis research
  62. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Summary of my thesis research
  63. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Transcription in the hippocampus is both plastic and robust Summary of my thesis research
  64. Things I’ve learned 34

  65. Things I’ve learned • Learning is hard to evaluate 34

  66. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted 34
  67. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific 34
  68. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific • Genomic sequencing can’t provide the answer for all biological questions 34
  69. 35 There is still so much to learn about learning,

    memory, and decision making
  70. Open and collaborative science is awesome! 36

  71. Open and collaborative science is awesome! • Collaborators Andre Fenton,

    Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  72. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  73. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  74. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  75. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  76. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  77. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  78. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  79. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  80. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  81. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36