Upgrade to Pro — share decks privately, control downloads, hide ads and more …

Transcriptional plasticity in the hippocampus ...

Sponsored · Your Podcast. Everywhere. Effortlessly. Share. Educate. Inspire. Entertain. You do you. We'll handle the rest.
Avatar for Rayna M Harris Rayna M Harris
December 18, 2017

Transcriptional plasticity in the hippocampus and its role in avoidance learning

Slides from my thesis defense talk.

Avatar for Rayna M Harris

Rayna M Harris

December 18, 2017

More Decks by Rayna M Harris

Other Decks in Science

Transcript

  1. Transcriptional plasticity in the hippocampus and its role in avoidance

    learning Rayna M. Harris Thesis Defense October 18, 2017 1
  2. 2 How do we learn the best and worst ways

    to navigate around Austin?
  3. The hippocampus is critical for remembering relationships in space and

    time 5 Hippocampus is the Greek word for Seahorse
  4. Spatial information flows through awesome neurons in the hippocampal circuit

    6 Weissman, Lichtman & Sanes, 2005 Ramón y Cajal 1911
  5. RNA sequencing allows us to measure the molecular response to

    learning 7 TCAGAATTTCTCAACGGTTCGAGATGGAAAGCAGCTTACGCCAGAGAGAGACTCCTCGAAACGTGTTCTG ACAGGATGCTTTCTCTCCCTGCTCATCTTCACCACGCTGCTAGGCAACACCCTGGTGTGCGCTGCCGTCA CCAAGTTCCGACACCTGAGGTCGAAGGTCACCAATTTCTTTGTCATCTCGCTGGCCATCTCTGACCTCCT GGTAGCTATTTTGGTAATGCCATGGAAGGCAGCGACAGAGATTGTGGGGTTTTGGCCGTTTGGTGCATTC TGCAACGTGTGGGTGGCATTTGACATAATGTGCTCCACTGCCTCCATCTTGAACTTGTGTGTGATTAGTG TCGATCGTTACTGGGCCATTTCAAGCCCATTCCGCTATGAACGCAAGATGACCCCTAAAGTAGCGTGTCT GATGATCAGTGTGGCATGGACCTTGTCTGTCCTCATCTCCTTCATTCCTGTTCAGCTTAACTGGCACAAA GCTCAGACCACCAGCTATGTCGAGCTAAATGGAACCTACCCTGATGATTTGCCCCCTGACAACTGTGACT TCAGTCTTAACAGGACCTATGCCATCTCCTCCTCCCTTATCAGCTTCTACATCCCCGTGGCAATTATGAT CGTCACTACACCCGGATCTACCGCATCGCCCAGACACAGATAAGGAGAATATCTGCTTTGGAGCGAGCA GCAGAGAGTGCCAAAAACCGACACAGCAGCATGGGAAACAGTTCAAACATGGACAGTGAGAGCTCATTTA AAATGTCATTCAAAAGAGAAACCAAAGTCTTAAAGACGCTCTCTGTCATAATGGGCGTGTTCGTGTGCTG CTGGTTGCCCTTCTTCATCCTAAACTGCATGGTTCCATTCTGTGAAACACACATGCCAGATGGATCCACA GAATTCCCCTGCATCAGCTCCACCACCTTTGATGTGTTTGTGTGGTTTGGCTGGGCAAACTCTTCGCTCA
  6. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 8
  7. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 8 Phenotypes Transcriptomics Genetic Manipulation Genes
  8. Outline of my thesis research 1. How does conditioned place

    avoidance learning alter transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 8 Harris et al. 2017 BioRxiv https://github.com/raynamharris/DissociationTest/ Phenotypes Transcriptomics Genetic Manipulation Genes
  9. A 5 year collaboration in conjunction with the Neural Systems

    & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
  10. A 5 year collaboration in conjunction with the Neural Systems

    & Behavior Course 2013 L-R: Me, Hans Hofmann, Ain Chung, André Fenton Additional Collaborators: Juan Marcos Alarcon, Hsin-Yi (Maddy) Kao 9 2017 students and faculty
  11. 11 Using “Active Place Avoidance Task” for conditioned avoidance learning

    A mouse in the Active Place Avoidance arena Carousel in Paris analogy
  12. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone
  13. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not
  14. Consistently trained, conflict trained, and yoked control groups 12 Yoked

    and trained mice are simultaneously shocked when the trained mouse enters the shock zone Trained mice show avoidance behavior while yoked mice do not Conflict mice have to learn a new spatial association and override an old one
  15. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session A B C
  16. Cognitive training protocol and behavioral responses 13 https://github.com/raynamharris/IntegrativeProjectWT2015/ • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Speed Max Avoidance Time Number of Entrances Hab. T1 T2 T3 Retest T4 T5 T6 Reten. 0 10 20 30 100 200 300 400 500 0.02 0.04 0.06 Training Session * * * A B C
  17. Additional behavioral measures illustrate that trained animals avoid the shock

    zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
  18. Additional behavioral measures illustrate that trained animals avoid the shock

    zone 14 https://github.com/raynamharris/IntegrativeProjectWT2015/
  19. Research questions 15 vs. vs. vs. vs. vs. vs. vs.

    vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  20. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  21. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  22. Research questions 15 vs. vs. vs. vs. 1. How does

    avoidance learning change gene expression in the hippocampus? 2. Do consistent and conflict training have the same effects? 3. Does receiving more shocks have an effect on the brain? vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. vs. s. s. vs. vs. vs.
  23. ~100 Genes in DG are unregulated in response to consistent

    cognitive training 19 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  24. Genes encoding transcription factors are up-regulated in DG in response

    to training 20 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  25. The CA1 response to both cognitive training and stressors 22

    https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  26. Cognitive training activates ion channel signaling and membrane transport 23

    https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  27. Additional stressors also activate ion channel signaling and membrane transport

    24 https://github.com/raynamharris/IntegrativeProjectWT2015/ Log Fold Change
  28. The classic molecular signaling cascade for learning also responds to

    stress 25 Ebert & Greenberg Nature 2013 Learning Stress Ebert & Greenberg 2013
  29. Slightly outta reach goal - identify genes that can increase

    or decrease learning 26 https://github.com/raynamharris/IntegrativeProjectWT2015/
  30. Chapter 2 1. How does conditioned place avoidance learning alter

    transcription in the hippocampal circuit? 2. How does the expression of a single gene influence learning and transcription or other genes? 3. How do laboratory methods influence our ability to understand the molecular substrates of learning? 27 Phenotypes Transcriptomics Genetic Manipulation Genes
  31. Genotype to phenotype mapping 30 Phenotypes Transcriptomics Genetic Manipulation Genes

    Behavior Transcriptomics Genetic Manipulation FMR1 Ebert & Greenberg Nature 2013
  32. FMR1 knock down has subtle effects on conditioned avoidance learning

    31 https://github.com/raynamharris/FMR1CA1rnaseq
  33. FMR1 knock down has subtle effects on conditioned avoidance learning

    31 https://github.com/raynamharris/FMR1CA1rnaseq
  34. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  35. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  36. FMR1 knock down has subtle effects on CA1 gene expression

    in yoked mice 32 https://github.com/raynamharris/FMR1CA1rnaseq
  37. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow Summary of my thesis research
  38. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Summary of my thesis research
  39. 33 I investigated learning at the molecular, neural, and behavioral

    levels I created an open and reproducible analysis workflow I found a striking pattern of transcriptional activity in DG in response to conditioned avoidance Transcription in the hippocampus is both plastic and robust Summary of my thesis research
  40. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted 34
  41. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific 34
  42. Things I’ve learned • Learning is hard to evaluate •

    Big, complex behavioral datasets can be summarized and interpreted • Neuromolecular responses are incredibly specific • Genomic sequencing can’t provide the answer for all biological questions 34
  43. Open and collaborative science is awesome! • Collaborators Andre Fenton,

    Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  44. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  45. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  46. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  47. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  48. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  49. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  50. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  51. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  52. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36
  53. Open and collaborative science is awesome! • My advisor, Hans

    Hofmann • Past and present Hofmann lab members (2009-2012-2017) • UT colleagues across departments and colleges • Thesis committee (Misha Matz Boris Zemelman, Laura Colgin, Andre Fenton) • Collaborators Andre Fenton, Maddy Kao, Ain Chung, Juan Marcos Alarcon at NYU & SUNY Downstate • The Neural Systems & Behavior Community • NSF, NIH, Grass Foundation, Promega, UT Grad School, Hemsley Foundation 36