AUCAGUCGAUCACCGAU transcription DNA RNA gene’s “expression level” = amount of RNA in cell that was transcribed from that gene What is gene expression? ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT
Data processing (1) put reads back where they came from (2) decide how to measure expression. One strategy: count number of reads originating from each gene expression = 24
Data processing (1) put reads back where they came from (2) decide how to measure expression. One strategy: count number of reads originating from each gene expression = 24 (lots of complexity here!)
CGAUCACCGAU AUCAGUCGAUCACCGAU AUCAGUCGAUC Example of a complication: DNA overlapping transcripts from same gene ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT
Data processing (1) put reads back where they came from (2) decide how to measure expression. One strategy: count number of reads originating from each gene expression = 24 (lots of complexity here!)
Is population structure also present in gene expression data? Makes sense that populations share DNA sequences, but do the genes themselves behave differently in different populations?
GEUVADIS gene expression data Genetic EUropean VAriation in health and DISease Raw gene expression data is publicly available for hundreds of individuals, so of course we couldn’t resist analyzing it ourselves. Two papers were published along with data release: one on scientific/biology findings (Lappalainen et al 2013, PMID 24037378) and one on technical patterns in gene expression data (‘t Hoen et al 2013, PMID 24037425)
GEUVADIS gene expression data 464 people 16,808 transcripts matrix entries: normalized expression measurement for person i, transcript j My software: https://github.com/alyssafrazee/ballgown & code: https://github. com/alyssafrazee/ballgown_code/tree/master/GEUVADIS_preprocessing for processing this data
Rich Data: more to explore ● genotype information ● some individual-level characteristics (e.g. sex) ● lots of technical information ● several individuals sequenced in replicate ● microRNA data ● raw & processed data available!
Which SNPs affect expression levels of other genes? expression level for transcript 5000 nucleotides away from Chr1, location 64,122,505 copies of non-canonical nucleotide at Chr1, location 64,122,505
(1) put reads back where they came from (2) decide how to measure expression. One strategy: count number of reads originating from each gene expression = 24 cancer data challenges ALL BETS ARE OFF
Image Credits ● human diversity: Simon Abrams, CC BY-SA 2.0 [link] ● tumor cells: cnicholsonpath (via Flickr), CC BY- SA 2.0 [link] ● awesome cast: Jennifer Carole, CC BY-NA 2.0 [link] ● transcription: National Library of Medicine, public domain [link] ● microarrays: Caricato da Schutz, CC BY 2.5 [link] ● cell differentiation: Rasback (via Wikipedia), CC BY-SA 2.5 [link] (I cropped it) ● fly life cycle: Image Editor (via Flickr), CC BY 2.0 [link]
Population structure: DNA data 1387 people 197,146 DNA locations where nucleotide varies matrix entries: how many copies of a “non- canonical” nucleotide at position j does person i have? (0, 1, or 2)