Adventures in Computational Biology

Adventures in Computational Biology

Introductory research talk given in the Department of Biology at Johns Hopkins, to high schoolers and high school teachers participating in the Molecular Biology and Genomics Research program.

567d15666cd2891a4e6c49e007f30a08?s=128

Alyssa Frazee

July 17, 2014
Tweet

Transcript

  1. Adventures in Computational Biology Alyssa Frazee Johns Hopkins biostatistics using

    statistics, math, biology, and computer programming to untangle the mysteries of gene expression
  2. gene expression: definition transcription DNA ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT! RNA AUCAGUCGAUCACCGAU! translation protein

  3. gene expression: definition transcription DNA ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT! RNA AUCAGUCGAUCACCGAU!

  4. gene expression: definition transcription DNA ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT! RNA AUCAGUCGAUCACCGAU! we can

    measure a gene’s expression level as the amount of RNA present in the cell that was transcribed from the gene
  5. transcription can get complex: splicing DNA ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT! RNA AUCAGUCGAUCACCGAU! AUCAGUCGAUC

    \! CGAUCACCGAU!
  6. so what? differences in gene expression and splicing have been

    implicated in: cell differentiation (Trapnell et al 2010)
  7. so what? differences in gene expression and splicing have been

    implicated in: organism development (Graveley 2010) image:  Chris,ne  Gerhart,  bit.ly/16h6P0Y.  license.    
  8. so what? differences in gene expression and splicing have been

    implicated in: cancer (Govindan 2012) image:  Wikimedia  Commons,   bit.ly/1cvKEc6    
  9. measuring expression: RNA-seq data Genome Transcripts RNA-seq reads (50-100 bp

    long) great for whole genomes / populations!
  10. next gen sequencing is awesome G C T A A

    G C T A F a Illumina/Solexa — Reversible terminators Incorporate all four nucleotides, each label with a different dye Repeat cycles T G C T G C T G C G C A T G C G C A T G C G C A T G C F F F F F F F F F F F F F F F F F F F F Cleave dye and terminating groups, wash Wash, four- colour imaging Metzker  2010  
  11. next gen sequencing is awesome Metzker  2010   Repeat cycles

    wa C G A T b CATCGT Top: Bottom: CCCCCC Figure 2 | Four-colour and one-colour cyclic reve termination (CRT) method uses Illumina/Solexa’s 3 solid-phase-amplified template clusters (FIG. 1b, sh imaging, a cleavage step removes the fluorescent tris(2-carboxyethyl)phosphine (TCEP)23. b | The fou
  12. @22:16362385-16362561W:ENST00000440999:2:177:-40:244:S/2! CCAGCCCACCTGAGGCTTCTTTTTCCTTCCCAAGCCACATCACCATCCTGGTGGAACTCTCCTGTGAGGACAGCCA +! GGFF<BB=>GBGIIIIIIIIIIIIIIEGEHGHHIIIIIIIIHFHBB2/:=??EGGGEGFHHIHHEDBD?@@DDHHD @22:16362385-16362561W:ENST00000440999:3:177:-56:294:S/2! GCGTGAGCCACAGGGCCCAGCCCACCTGAGGCTTCTTTTTCCTTCCCAAGCCACATCACCATCCTGGTGGAACTCT +! @=ABBBBIIIIIIIIHHGGGGIIDBDIIIIIIGIIIIHIIIIHFDD@BBDBGGFIDEE8DCC/29>BGFCGHHHGF @22:16362385-16362561W:ENST00000440999:4:177:137:254:S/1! TCACCATCCTGGTGGAACTCTCCTGTGAGGACAGCCAAGGCCTGAACTACCTGCaGTGGGGAGCACCTCAGGGTTT

    +! DDGBBCGGGIGGGBDDDHIIGGDGD77=BDIIIIIIIIFHHHHIIIHEFFHGGDD8A>DEGHHIFDDHH8@BEDDI @22:16362385-16362561W:ENST00000440999:5:177:68:251:S/2! AGGGTTTGCCCAGGCAACCAGCCAGCCCTGGTCCAAGGCATCCTGGAGCGAGTTGTGGATGGCaaaaaGaCnCgCC +! HIGHIHFHEGE4111:.;8@?@HDIIIIIIIEGGIHHHIIGA?=:FIIIDD8.02506A8=AC############# @22:16362385-16362561W:ENST00000440999:6:177:348:453:S/1! AAGGCCTGAACTACCTGCGGTGGGGAGCACCTCAGGGTTTGCCCAGGCAACCAGCCAGCCCTGGTCCAAGGCATCC +! B9?@8=42:E@GDEDIIIIIGGHIIIFBEEAGIIDIIDHHGGHIIEGEIIIIIHIHFHFFEEFGGGGGB88>:DGH @22:51205934-51222090C:ENST00000464740:132:612:223:359:S/2! GGAAGTATGATGCTGATGACAACGTGAAGATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGA +! IIEHHHHHIIIIIIIHGGDGHHEDDG8=;?==19;<<>D@@GGGIIHIIHGGDDHGBA=ABEG@@DFCCAA<:=>8 @22:51205934-51222090C:ENST00000464740:125:612:-1:185:S/1! TGGAGTGCGCTGCGGCGCGAGCTGGGCCGGCGGGCGTGGTTCGAGAGCGCGCAGAGTCCAGACTGGCGGCAGGGCC +! HHIIIHIDGG@;=@GIIIIIDDGBBBEDB@8>5554,/':9B@@C?==@1:2@?=GG=;<HHHHGIIHHEC-;;3?
  13. ©  Allie  Brosh,  Hyperbole  and  a  Half.     hLp://bit.ly/1mImIJx

      (I try to avoid this)
  14. analyzing the data, step (1): alignment   match reads back

    to their original genomic location genome lide  credit:  Jeff    
  15. analyzing the data, step (2): assembly! reconstruct transcripts from read

    alignments Genome Fragments Transcripts lide  credit:  Jeff    
  16. Genome equally likely assemblies analyzing the data, step (2): assembly!

    ASSEMBLY IS A REALLY DIFFICULT PROBLEM
  17. Genome analyzing the data, step (2): assembly! ASSEMBLY IS A

    REALLY DIFFICULT PROBLEM …but researchers are motivated to solve it because data-driven assembly allows for discovery
  18. None
  19. None
  20. Genome Transcripts lide  credit:  Jeff     analyzing the data,

    step (3): estimate expression! How many reads originated from each transcript?
  21. analyzing the data, step (4): differential expression testing Is the

    mean abundance for transcript X the same in population A and population B? transcripts flag as differentially expressed population A population B
  22. our proposed pipeline: Ballgown image:  bit.ly/HBbLaO  

  23. our proposed pipeline: Ballgown align with TopHat

  24. our proposed pipeline: Ballgown align with TopHat (which depends on

    Bowtie
  25. our proposed pipeline: Ballgown align with TopHat assemble with Cufflink

  26. our proposed pipeline: Ballgown align with TopHat assemble with Cufflink

    analyze with Ballgown
  27. align assemble estimate abundances organize output •  visualize assembly structure

    •  postprocess assembly if necessary •  test for differential expression [use tool of your choice] Ballgown
  28. visualize 51210000 51215000 51220000 genomic position 0 78.92 157.84 236.76

    315.68 394.61 473.53 552.45 631.37 713.88 expression, by transcript gene XLOC_000454, sample 1
  29. check 51210000 51215000 51220000 genomic position Assembled and Annotated Transcripts

    annotated assembled
  30. fix? 51210000 51215000 51220000 genomic position Assembled and Annotated Transcripts

    annotated assembled
  31. test for differential expression

  32. test for differential expression recall! we want to know if

    the mean abundance for transcript X is the same in population A and population B. transcripts flag as differentially expressed population A population B
  33. test for differential expression LINEAR REGRESSION IN FIFTEEN MINUTES!

  34. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  35. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  36. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) this seems like a good line! y=mx + b
  37. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) but wait! is this line better?
  38. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) or perhaps this one?
  39. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) what does “better” even mean?
  40. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  41. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) the y-axis distance from a fitted line to a data point is called a “residual”
  42. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) “best” line has minimum “sum of squared residuals”
  43. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) The Best Line for this data
  44. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female
  45. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female regression can handle it!
  46. • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female regression can handle it!
  47. what do we learn from regression? y = a +

    b1 x weight = 20.9 + 1.53*height slope? intercept?
  48. what do we learn from regression? y = a +

    b1 x1 + b2 x2 weight = 55.2 + 0.935*height + 9.76(if male) slope(s)? intercept?
  49. nice statistical tests exist to help us decide which model

    is better • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches)
  50. back to molecular biology! for each transcript, fit 2 linear

    regression models: model A: includes “disease” as covariate model B: does not include disease aaa Y is expression (# of RNA-seq reads) X is “disease status” if model A fits better than model B, then disease status has something to do with expression of that transcript
  51. a real-world example 6 7 8 9 10 0 1

    2 3 4 RIN log2(transcript expression + 1) transcript 2208, chr1: 17732159−17739760 YRI CEU FIN GBR TSI 6 7 8 9 10 0.0 0.5 1.0 1.5 2.0 RIN log2(transcript expression + 1) transcript 295456, chr8: 52729948−52814118 YRI CEU FIN GBR TSI
  52. a real-world example Applicable to other data! I’ve done projects

    on: •  cancer •  psychiatric disease •  stem cells
  53. None
  54. other “flavors” of linear models for gene expression: •  EdgeR

    and DESeq (“generalized” linear models) •  limma (empirical Bayes approach)
  55. on our way

  56. thank you! contact (please feel free): email: alyssa.frazee@gmail.com twitter: @acfrazee

    website: alyssafrazee.com My collaborators: Jeff Leek (advisor), Geo Pertea, Steven Salzberg, Ben Langmead, Andrew Jaffe, and several others in the Center for Computational Biology and biostatistics department
  57. references (by PubMed ID) •  Ballgown paper: http://biorxiv.org/content/early/ 2014/03/30/003665 • 

    Cufflinks: 20436464 (Trapnell et al 2010) •  EdgeR: 19910308 (Robinson et al 2010) •  DESeq: 20979621 (Anders and Huber 2010) •  Limma: “Linear Models for Microarray Data” by Gordon K Smyth, in Bioinformatics and Computational Biology Solutions using R and Bioconductor, Springer 2005; 24485249 (Law et al 2014) •  Drosophila life cycle: 21179090 (Graveley et al 2011) •  Isoforms & cancer: 22980976 (Govindan et al 2012) •  cell differentiation: 20436464 (Cufflinks; Trapnell et al 2010) •  Next generation sequencing paper/figures: 19997069 (Metzker 2010) •  image sources: http://bit.ly/16h6P0Y, http://bit.ly/1cvKEc6, http://bit.ly/19TaSH9, http://bit.ly/12pNREw, http://bit.ly/HBbLaO