Adventures in Computational Biology

Adventures in Computational Biology

Introductory research talk given in the Department of Biology at Johns Hopkins, to high schoolers and high school teachers participating in the Molecular Biology and Genomics Research program.

567d15666cd2891a4e6c49e007f30a08?s=128

Alyssa Frazee

July 17, 2014
Tweet

Transcript

  1. 1.

    Adventures in Computational Biology Alyssa Frazee Johns Hopkins biostatistics using

    statistics, math, biology, and computer programming to untangle the mysteries of gene expression
  2. 4.

    gene expression: definition transcription DNA ACTGACCTAGATCAGTCGATCGATCGTATACGATTACAAAATCATCGGCAT! RNA AUCAGUCGAUCACCGAU! we can

    measure a gene’s expression level as the amount of RNA present in the cell that was transcribed from the gene
  3. 6.

    so what? differences in gene expression and splicing have been

    implicated in: cell differentiation (Trapnell et al 2010)
  4. 7.

    so what? differences in gene expression and splicing have been

    implicated in: organism development (Graveley 2010) image:  Chris,ne  Gerhart,  bit.ly/16h6P0Y.  license.    
  5. 8.

    so what? differences in gene expression and splicing have been

    implicated in: cancer (Govindan 2012) image:  Wikimedia  Commons,   bit.ly/1cvKEc6    
  6. 10.

    next gen sequencing is awesome G C T A A

    G C T A F a Illumina/Solexa — Reversible terminators Incorporate all four nucleotides, each label with a different dye Repeat cycles T G C T G C T G C G C A T G C G C A T G C G C A T G C F F F F F F F F F F F F F F F F F F F F Cleave dye and terminating groups, wash Wash, four- colour imaging Metzker  2010  
  7. 11.

    next gen sequencing is awesome Metzker  2010   Repeat cycles

    wa C G A T b CATCGT Top: Bottom: CCCCCC Figure 2 | Four-colour and one-colour cyclic reve termination (CRT) method uses Illumina/Solexa’s 3 solid-phase-amplified template clusters (FIG. 1b, sh imaging, a cleavage step removes the fluorescent tris(2-carboxyethyl)phosphine (TCEP)23. b | The fou
  8. 12.

    @22:16362385-16362561W:ENST00000440999:2:177:-40:244:S/2! CCAGCCCACCTGAGGCTTCTTTTTCCTTCCCAAGCCACATCACCATCCTGGTGGAACTCTCCTGTGAGGACAGCCA +! GGFF<BB=>GBGIIIIIIIIIIIIIIEGEHGHHIIIIIIIIHFHBB2/:=??EGGGEGFHHIHHEDBD?@@DDHHD @22:16362385-16362561W:ENST00000440999:3:177:-56:294:S/2! GCGTGAGCCACAGGGCCCAGCCCACCTGAGGCTTCTTTTTCCTTCCCAAGCCACATCACCATCCTGGTGGAACTCT +! @=ABBBBIIIIIIIIHHGGGGIIDBDIIIIIIGIIIIHIIIIHFDD@BBDBGGFIDEE8DCC/29>BGFCGHHHGF @22:16362385-16362561W:ENST00000440999:4:177:137:254:S/1! TCACCATCCTGGTGGAACTCTCCTGTGAGGACAGCCAAGGCCTGAACTACCTGCaGTGGGGAGCACCTCAGGGTTT

    +! DDGBBCGGGIGGGBDDDHIIGGDGD77=BDIIIIIIIIFHHHHIIIHEFFHGGDD8A>DEGHHIFDDHH8@BEDDI @22:16362385-16362561W:ENST00000440999:5:177:68:251:S/2! AGGGTTTGCCCAGGCAACCAGCCAGCCCTGGTCCAAGGCATCCTGGAGCGAGTTGTGGATGGCaaaaaGaCnCgCC +! HIGHIHFHEGE4111:.;8@?@HDIIIIIIIEGGIHHHIIGA?=:FIIIDD8.02506A8=AC############# @22:16362385-16362561W:ENST00000440999:6:177:348:453:S/1! AAGGCCTGAACTACCTGCGGTGGGGAGCACCTCAGGGTTTGCCCAGGCAACCAGCCAGCCCTGGTCCAAGGCATCC +! B9?@8=42:E@GDEDIIIIIGGHIIIFBEEAGIIDIIDHHGGHIIEGEIIIIIHIHFHFFEEFGGGGGB88>:DGH @22:51205934-51222090C:ENST00000464740:132:612:223:359:S/2! GGAAGTATGATGCTGATGACAACGTGAAGATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGA +! IIEHHHHHIIIIIIIHGGDGHHEDDG8=;?==19;<<>D@@GGGIIHIIHGGDDHGBA=ABEG@@DFCCAA<:=>8 @22:51205934-51222090C:ENST00000464740:125:612:-1:185:S/1! TGGAGTGCGCTGCGGCGCGAGCTGGGCCGGCGGGCGTGGTTCGAGAGCGCGCAGAGTCCAGACTGGCGGCAGGGCC +! HHIIIHIDGG@;=@GIIIIIDDGBBBEDB@8>5554,/':9B@@C?==@1:2@?=GG=;<HHHHGIIHHEC-;;3?
  9. 14.

    analyzing the data, step (1): alignment   match reads back

    to their original genomic location genome lide  credit:  Jeff    
  10. 15.

    analyzing the data, step (2): assembly! reconstruct transcripts from read

    alignments Genome Fragments Transcripts lide  credit:  Jeff    
  11. 17.

    Genome analyzing the data, step (2): assembly! ASSEMBLY IS A

    REALLY DIFFICULT PROBLEM …but researchers are motivated to solve it because data-driven assembly allows for discovery
  12. 18.
  13. 19.
  14. 20.

    Genome Transcripts lide  credit:  Jeff     analyzing the data,

    step (3): estimate expression! How many reads originated from each transcript?
  15. 21.

    analyzing the data, step (4): differential expression testing Is the

    mean abundance for transcript X the same in population A and population B? transcripts flag as differentially expressed population A population B
  16. 27.

    align assemble estimate abundances organize output •  visualize assembly structure

    •  postprocess assembly if necessary •  test for differential expression [use tool of your choice] Ballgown
  17. 28.

    visualize 51210000 51215000 51220000 genomic position 0 78.92 157.84 236.76

    315.68 394.61 473.53 552.45 631.37 713.88 expression, by transcript gene XLOC_000454, sample 1
  18. 32.

    test for differential expression recall! we want to know if

    the mean abundance for transcript X is the same in population A and population B. transcripts flag as differentially expressed population A population B
  19. 34.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  20. 35.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  21. 36.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) this seems like a good line! y=mx + b
  22. 37.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) but wait! is this line better?
  23. 38.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) or perhaps this one?
  24. 39.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) what does “better” even mean?
  25. 40.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs)
  26. 41.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) the y-axis distance from a fitted line to a data point is called a “residual”
  27. 42.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) “best” line has minimum “sum of squared residuals”
  28. 43.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) The Best Line for this data
  29. 44.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female
  30. 45.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female regression can handle it!
  31. 46.

    • • • • • • • • • •

    • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female regression can handle it!
  32. 47.

    what do we learn from regression? y = a +

    b1 x weight = 20.9 + 1.53*height slope? intercept?
  33. 48.

    what do we learn from regression? y = a +

    b1 x1 + b2 x2 weight = 55.2 + 0.935*height + 9.76(if male) slope(s)? intercept?
  34. 49.

    nice statistical tests exist to help us decide which model

    is better • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches) Weight (lbs) male female • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 55 60 65 70 75 80 100 120 140 160 Heights and Weights of 500 Adults Height (inches)
  35. 50.

    back to molecular biology! for each transcript, fit 2 linear

    regression models: model A: includes “disease” as covariate model B: does not include disease aaa Y is expression (# of RNA-seq reads) X is “disease status” if model A fits better than model B, then disease status has something to do with expression of that transcript
  36. 51.

    a real-world example 6 7 8 9 10 0 1

    2 3 4 RIN log2(transcript expression + 1) transcript 2208, chr1: 17732159−17739760 YRI CEU FIN GBR TSI 6 7 8 9 10 0.0 0.5 1.0 1.5 2.0 RIN log2(transcript expression + 1) transcript 295456, chr8: 52729948−52814118 YRI CEU FIN GBR TSI
  37. 52.

    a real-world example Applicable to other data! I’ve done projects

    on: •  cancer •  psychiatric disease •  stem cells
  38. 53.
  39. 54.

    other “flavors” of linear models for gene expression: •  EdgeR

    and DESeq (“generalized” linear models) •  limma (empirical Bayes approach)
  40. 56.

    thank you! contact (please feel free): email: alyssa.frazee@gmail.com twitter: @acfrazee

    website: alyssafrazee.com My collaborators: Jeff Leek (advisor), Geo Pertea, Steven Salzberg, Ben Langmead, Andrew Jaffe, and several others in the Center for Computational Biology and biostatistics department
  41. 57.

    references (by PubMed ID) •  Ballgown paper: http://biorxiv.org/content/early/ 2014/03/30/003665 • 

    Cufflinks: 20436464 (Trapnell et al 2010) •  EdgeR: 19910308 (Robinson et al 2010) •  DESeq: 20979621 (Anders and Huber 2010) •  Limma: “Linear Models for Microarray Data” by Gordon K Smyth, in Bioinformatics and Computational Biology Solutions using R and Bioconductor, Springer 2005; 24485249 (Law et al 2014) •  Drosophila life cycle: 21179090 (Graveley et al 2011) •  Isoforms & cancer: 22980976 (Govindan et al 2012) •  cell differentiation: 20436464 (Cufflinks; Trapnell et al 2010) •  Next generation sequencing paper/figures: 19997069 (Metzker 2010) •  image sources: http://bit.ly/16h6P0Y, http://bit.ly/1cvKEc6, http://bit.ly/19TaSH9, http://bit.ly/12pNREw, http://bit.ly/HBbLaO