Upgrade to Pro — share decks privately, control downloads, hide ads and more …

"Bioruby"...understanding the intricacies of 'L...

Sponsored · SiteGround - Reliable hosting with speed, security, and support you can count on.
Avatar for Doel Doel
November 08, 2013

"Bioruby"...understanding the intricacies of 'Life' using Ruby

Presented in RubyConf Miami, 2013 the topic on how BioRuby eases the life of Bioinformaticians and what the it is?
Learn about the genes, which controls everything you do and find out how you can ease the task of your similarity with a salamander using Bioruby!

Bioruby is great Bioinformatics tool which helps to process biological data and analyze it. 5 years after ruby programming language came into vogue(1995), bioruby came into existence in 2000, both developed in Japan. BioRuby project provides an integrated environment in bioinformatics for the Ruby language. This project is supported by University of Tokyo (Human Genome Center), Kyoto University (Bioinformatics Center) and the Open Bio Foundation.Welcome to the ruby in the living world, integrating ruby with the Bioinformatics and have fun.

On one hand we have the Bioinformatics, the large database of the huge genome sequences, the search algorithms to search the gene similarity between different organisms, gene-mutations using the popular search tool Blast, Fasta etc. BioRuby helps us to do the same searching thing using ruby programming language. As ruby is a pure object-oriented programming language(everything in ruby is an object) and being a easy to read and write, it's fun to use here without being lost in the plethora of genomic data.

One of the greatest contributions from Bioruby is Biogems, which like any other rubygems helps to perform modular approaches in order to perform specific functionality. One such gem is bio-ucsc-api gem, which helps to fetch record from UCSC DB and the best part is the gem has been implemented using the Actice Record Framework thereby easing the record fetch, instead of complex sql queries. We explained the basic concepts of Gene, DNA. RNA, Amino-acids, Human Genome Project and how these huge data are stored and analyzed by the famous Bioinformatics tools like BLAST, Fasta and how Bioruby interacts with the different biological databases like Genbank, Swissprot etc.

Avatar for Doel

Doel

November 08, 2013

More Decks by Doel

Other Decks in Technology

Transcript

  1. DNA

  2. Does this sequence seems ok? AATTGGTTTGCTATATCCCGTCTCTCTAGCTAGATATTTCA TATACGCCCGTCTCTCTAATTGCACTCCATAGCTATATGA GCTATCGTAGTDGATGCTAAGCAGCAGTGCACTAGATATC ATTTGOTAATATGCTAATTTGCCGTCGATCGGATCPAGCA TCTATTCTATTCTGFGCTATCTATTCTCTGCTACGGAACTG

    GCTGCTGATCTCTCTTAGCTAGCTTCTCTATTACGTTGCCA ATATATDTGATGCCCTAGCTGAGAGTCGATAACGTTCGAG CTGCGCGTTCGCGGTAGCGGATGCGTATGTTCAAGCCAT GCTGAGCTGAGCTGAGGAGAGTCGTATCGATTCGGGATC TCTTAGCTAQCTTCTCTATATTACGTTGCATGATGCCGTAG CTGCGCGTTCGCGGTAGCGGATGCGTATGTTCAAGCCAT
  3. • An international research effort • HGP was done to

    sequence all genes (genome) of our species, Homo sapiens. • Completed in April 2003. • Approx 3 Billion base pairs are present in each human. • 3GB data stored in each cell • 75-100 trillion cells in body(along with the bacteria and all)
  4. History of Bioruby • Nov 2000 Bioruby Start • June2001

    1st version of Bioruby • 2005-2006 IPA Exploratory Software Project • Feb 2006 Bioruby 1.0.0 released • Sept 2008 Moved CVS to GIT • Aug 2010 Published Bioruby Research Paper • May 2013 Bioruby 1.4.3.0001 (Latest stable version of Bioruby)
  5. References BioRuby The Ruby UCSC API: accessing the UCSC genome

    database using Ruby NCBI Blast Tutorial yw-jakartarb20101031key By Yannick Wurm bioruby-bioinformatics-library By Naohisa Goto bonnal-bosc2010-bioruby By Raoul J.P Bonnal