Upgrade to Pro — share decks privately, control downloads, hide ads and more …

Genomic sketching with HyperLogLog

Avatar for Ben Langmead Ben Langmead
November 07, 2019

Genomic sketching with HyperLogLog

Sketch data structures can be used to distill huge genomics datasets into small summaries. Sketches can then be compared to find, for example, the degree of k-mer similarity between two datasets. This is the basis for a growing number of bionformatics tools solving an array of problems, e.g. clustering genomes, searching for datasets with certain sequence content, accelerating the overlapping step in genome assemblers, or mapping sequencing reads.

I will discuss the basic problems addressed by sketches, with a focus on MinHash and HyperLogLog. I will suggest a unified way of thinking about these, which are often described in different terms (e.g. "ordered" versus "bit-pattern observable"). I will further relate these structures to Bloom filters, which have found many applications in bioinformatics.

Finally, I will discuss how HyperLogLog is used in the new Dashing software tool, which tackles a similar set of sequence-similarity problems as Mash and BinDash. I will show how HyperLogLog helps address a major issue with MinHash, namely its lower accuracy in cases where one of the sets being compared is much smaller than the other. Finally, I will discuss how the ability to create sketches efficiently enables further accuracy improvements, for example, by making it easier to sketch across an array of k-mer sizes.

Avatar for Ben Langmead

Ben Langmead

November 07, 2019

More Decks by Ben Langmead

Other Decks in Research

Transcript

  1. Ben Langmead JHU Computer Science [email protected], langmead-lab.org, @BenLangmead Genome Informatics,

    Cold Spring Harbor Laboratory November, 2019 Genomic sketching with HyperLogLog Tweetable
  2. Sketching How to sift and summarize huge datasets so we

    can answer similarity questions later? Genomes Sequencing data Image: doi:10.1038/nbt.4229
 Image: doi:10.1038/s41576-018-0088-9
  3. Cardinality Biological relatedness AGGCCACAGTGTATTATGACTG ||||||||||| ||||||||| AGGCCACAGTGAGTTATGACTG AAAAAAAAAAAGATGT-AAGTA |||||||||||||||| |||||

    AAAAAAAAAAAGATGTAAAGTA GAGG--TCAGATTCACAGCCAC |||| |||||||||||||||| GAGGGGTCAGATTCACAGCCAC Set similarities J = |A ∩ B| |A ∪ B| Cardinalities |A| |B| |A ∪ B| |A ∩ B| C = |A ∩ B| |A|
  4. 342 830 017 332 525 092 709 I take cards

    labeled 1--1,000 and choose a random subset of size n to hide in my hat You may see one representative from the cards in the hat; which to pick? You would like to estimate n Hat problem
  5. What if minimum was 500? Estimate should grow as minimum

    shrinks ...10? ... 4? Hat problem 0 999 min = 40 40 ≈ 1000/(n + 1) n ≈ 24 Easy to compute, fits in 10 bits
  6. Hat analogy seems contrived... ...but matches the situation where we

    hash items up front 0x39AD49CC 0x9FAA176B h(x) <latexit sha1_base64="3LcopZtEpejfqLYR7b/0BGglZ0w=">AAAB63icbZDLSgMxFIbP1Futt6pLN8Ei1E2ZEUGXRTcuK9gLtEPJpJlOaJIZkoxYhr6CGxeKuPWF3Pk2ZtpZaOsPgY//nEPO+YOEM21c99spra1vbG6Vtys7u3v7B9XDo46OU0Vom8Q8Vr0Aa8qZpG3DDKe9RFEsAk67weQ2r3cfqdIslg9mmlBf4LFkISPY5FZUfzofVmtuw50LrYJXQA0KtYbVr8EoJqmg0hCOte57bmL8DCvDCKezyiDVNMFkgse0b1FiQbWfzXedoTPrjFAYK/ukQXP390SGhdZTEdhOgU2kl2u5+V+tn5rw2s+YTFJDJVl8FKYcmRjlh6MRU5QYPrWAiWJ2V0QirDAxNp6KDcFbPnkVOhcNz/L9Za15U8RRhhM4hTp4cAVNuIMWtIFABM/wCm+OcF6cd+dj0Vpyiplj+CPn8wdvb43T</latexit> <latexit sha1_base64="3LcopZtEpejfqLYR7b/0BGglZ0w=">AAAB63icbZDLSgMxFIbP1Futt6pLN8Ei1E2ZEUGXRTcuK9gLtEPJpJlOaJIZkoxYhr6CGxeKuPWF3Pk2ZtpZaOsPgY//nEPO+YOEM21c99spra1vbG6Vtys7u3v7B9XDo46OU0Vom8Q8Vr0Aa8qZpG3DDKe9RFEsAk67weQ2r3cfqdIslg9mmlBf4LFkISPY5FZUfzofVmtuw50LrYJXQA0KtYbVr8EoJqmg0hCOte57bmL8DCvDCKezyiDVNMFkgse0b1FiQbWfzXedoTPrjFAYK/ukQXP390SGhdZTEdhOgU2kl2u5+V+tn5rw2s+YTFJDJVl8FKYcmRjlh6MRU5QYPrWAiWJ2V0QirDAxNp6KDcFbPnkVOhcNz/L9Za15U8RRhhM4hTp4cAVNuIMWtIFABM/wCm+OcF6cd+dj0Vpyiplj+CPn8wdvb43T</latexit> <latexit sha1_base64="3LcopZtEpejfqLYR7b/0BGglZ0w=">AAAB63icbZDLSgMxFIbP1Futt6pLN8Ei1E2ZEUGXRTcuK9gLtEPJpJlOaJIZkoxYhr6CGxeKuPWF3Pk2ZtpZaOsPgY//nEPO+YOEM21c99spra1vbG6Vtys7u3v7B9XDo46OU0Vom8Q8Vr0Aa8qZpG3DDKe9RFEsAk67weQ2r3cfqdIslg9mmlBf4LFkISPY5FZUfzofVmtuw50LrYJXQA0KtYbVr8EoJqmg0hCOte57bmL8DCvDCKezyiDVNMFkgse0b1FiQbWfzXedoTPrjFAYK/ukQXP390SGhdZTEdhOgU2kl2u5+V+tn5rw2s+YTFJDJVl8FKYcmRjlh6MRU5QYPrWAiWJ2V0QirDAxNp6KDcFbPnkVOhcNz/L9Za15U8RRhhM4hTp4cAVNuIMWtIFABM/wCm+OcF6cd+dj0Vpyiplj+CPn8wdvb43T</latexit> <latexit sha1_base64="3LcopZtEpejfqLYR7b/0BGglZ0w=">AAAB63icbZDLSgMxFIbP1Futt6pLN8Ei1E2ZEUGXRTcuK9gLtEPJpJlOaJIZkoxYhr6CGxeKuPWF3Pk2ZtpZaOsPgY//nEPO+YOEM21c99spra1vbG6Vtys7u3v7B9XDo46OU0Vom8Q8Vr0Aa8qZpG3DDKe9RFEsAk67weQ2r3cfqdIslg9mmlBf4LFkISPY5FZUfzofVmtuw50LrYJXQA0KtYbVr8EoJqmg0hCOte57bmL8DCvDCKezyiDVNMFkgse0b1FiQbWfzXedoTPrjFAYK/ukQXP390SGhdZTEdhOgU2kl2u5+V+tn5rw2s+YTFJDJVl8FKYcmRjlh6MRU5QYPrWAiWJ2V0QirDAxNp6KDcFbPnkVOhcNz/L9Za15U8RRhhM4hTp4cAVNuIMWtIFABM/wCm+OcF6cd+dj0Vpyiplj+CPn8wdvb43T</latexit> 0xDF89114B { , , , , , ..., } Hat problem - hash function
  7. Two-hat problem B A Can we estimate cardinality of unions?

    Intersections? About coincidences Cardinalities |A| |B| |A ∪ B| |A ∩ B|
  8. A B Space of coincidences is large Image inspired by:

    Ondov B, Starrett G, Sappington A, Kostic A, Koren S, Buck CB, Phillippy AM. Mash Screen: high-throughput sequence containment estimation for genome discovery. Genome Biol 20, 232 (2019) Need multiple representatives per set Two-hat problem
  9. Bottom k A B Instead of minimum only, consider "bottom

    3" "Bottom-k sketch" can estimate cardinalities of unions and intersections Larger k averages more, improving estimate
  10. k-partition A B Instead of bottom-3, consider minimum in each

    of 3 partitions Accomplishes something similar to bottom-k
  11. Mash Bottom-k MinHash sketch 1. Ondov BD, Treangen TJ, Melsted

    P, Mallonee AB, Bergman NH, Koren S, Phillippy AM. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol. 2016 Jun 20;17(1):132. 2. Broder AZ. On the resemblance and containment of documents. Compression and Complexity of Sequences 1997 - Proceedings 1998:21–29. A B Image: ref 1
  12. Mash Representative fits in bits U is often 32 or

    64 ⌈log2 U⌉ 1. Ondov BD, Treangen TJ, Melsted P, Mallonee AB, Bergman NH, Koren S, Phillippy AM. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol. 2016 Jun 20;17(1):132. Image: ref 1
  13. Log vs LogLog Instead of minimum, say we use log-minimum

    min 0x030F6556 ⌊log2 ⌋ 25 Estimate is of ; can re-exponentiate later, but with added variance & bias ⌊log2 n⌋ Representatives take rather than bits log log U log U Pro: Con: 32 bits 6 x 5 bits
  14. Dashing Daniel Baker Baker DN, Langmead B. Dashing: fast and

    accurate genomic distances with HyperLogLog. In press, Genome Biology. http://bit.ly/dash_pre Software: https://github.com/dnbaker/dashing Library: https://github.com/dnbaker/sketch Many methods implemented, not just HLL MinHash, Bloom filters, Mod sketch, bBit Minwise, CountMin, Count sketch, HeavyKeeper, ...
  15. HyperLogLog HLL Input items 11110011 11110011 11110011 11110011 001 01001

    110 00001 ... ... Hash values ⛺ ... ... Register 000 01001 10001 10101 10110 00100 Register 001 00100 10110 01011 10101 00010 01011 11111 11110 Register 010 Register 011 Register 111 ... Hash Take prefix Cardinality Estimate 3 2 ~ 22 ~ 23 ... ... ... ... p q ... ... ... ... Overall Estimate Baker DN, Langmead B. Dashing: fast and accurate genomic distances with HyperLogLog. In press, Genome Biology. 1. k-partition 2. ⌊log2 n⌋ 3. Re-exponentiation 4. Averaging, bias correction
  16. Trick 1: SIMD instructions 8-bit registers well suited to vectorized

    (SIMD) instructions Union equals elementwise min: HLL(A) HLL(B) HLL(A U B) PMINUB VPMINUB VPMINUB AVX2 AVX512-BW SSE2 ... ... ...
  17. Trick 2: Changing log base 0x030F65A691DD9010 25 64 bits 6

    bits ⌊log1.19 ⌋ 8 bits min ⌊log2 ⌋ 101 Waste Register array Register array LZC or
  18. Dashing HLL handles lopsided sets better than bottom-k MinHash 1,2

    1. Koslicki, David, and Hooman Zabeti. Improving MinHash via the containment index with applications to metagenomic analysis. Applied Mathematics and Computation 354 (2019): 206-215. 2. Ondov B, Starrett G, Sappington A, Kostic A, Koren S, Buck CB, Phillippy AM. Mash Screen: high-throughput sequence containment estimation for genome discovery. Genome Biol 20, 232 (2019) MinHash HLL J = 0.111 |J − ̂ J| log2 (sketch bytes)
  19. Dashing • • • • • • • • •

    • • • • • • • −0.2 −0.1 0.0 0.1 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6, 0.7) [0.7, 0.8) [0.8, 0.9) [0.9, 1) True J Est J − True J k = 16, log2 (sketch bytes) = 10 • • • • • • • • • • • • • • • • • • • • −0.025 0.000 0.025 0.050 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6, 0.7) [0.7, 0.8) [0.8, 0.9) True J Est J − True J k = 16, log2 (sketch bytes) = 14 • 0.2 0.3 k = 21, log2 (sketch bytes) = 10 • • 0.06 k = 21, log2 (sketch bytes) = 14 • • • • • • • • • −0.2 −0.1 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6, 0.7) [0.7, 0.8) [0.8, 0.9) [0.9, 1) True J −0.06 −0.03 [0, 0. Mash BinDash Dashin More accurate than Mash comparing real genome pairs at various similarities; BinDash is competitive |J − ̂ J| True J • • • • • • • • • • • • • • −0.2 −0.1 0.0 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6, 0.7) [0.7, 0.8) [0.8, 0.9) [0.9, 1) True J Est J −0.06 −0.03 0.00 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3 Est J Mash BinDash Dashing (MLE) • • • • • • • • • • • • • • • • • • • • −0.2 −0.1 0.0 0.1 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6, 0.7) [0.7, 0.8) [0.8, 0.9) [0.9, 1) True J Est J − True • • • • • • −0.06 −0.03 0.00 0.03 [0, 0.1) [0.1, 0.2) [0.2, 0.3) [0.3, 0.4) [0.4, 0.5) [0.5, 0.6) [0.6 True J Est J − True Mash BinDash Dashing (MLE) k = 16 1 KB sketch * Zhao X. BinDash, software for fast genome distance estimation on a typical personal laptop. Bioinformatics. 2019 Feb 15;35(4):671-673. *
  20. Dashing Dashing sketches and performs all-pairs distance calculations for 87,113

    bacterial genomes in ~6m Fastest at sketching in general; fastest overall (incl. distance estimation) for small sketches Sketching All-pairs distances Wall clock Peak mem Wall clock Peak mem Mash 22m25s 17 GB 31m41s 1.1 GB BinDash 19m17s 141 MB 1m14s 409 Dashing 4m31s 13 GB 1m40s 116 k = 31 1 KB sketch Versus ~20m for BinDash, ~54m for Mash 100 threads
  21. Future work Multi-k sketching Weighted Jaccard Indexing public data with

    HLLs How to synthesize various k-mer lengths? How to restore multiplicity information? Does this require a new sketch, or just an "adapter" for HLL?
  22. Funding: • NSF: IIS-1349906 • NIH: R01GM118568 • XSEDE: TG-CIE170020

    Looking for Ph.D. students; write to [email protected] or chat with me Daniel Baker JHU: • Brad Solomon Software: https://github.com/dnbaker/dashing Library: https://github.com/dnbaker/sketch Preprint: http://bit.ly/dash_pre MinHash HyperLogLog Representatives come from min Store representatives in log U bits Representatives come from log-min (LZC) Bottom-k for averaging (in Mash) k-partition for averaging Store representatives in log log U bits
  23. References Broder AZ. On the resemblance and containment of documents.

    Compression and Complexity of Sequences 1997 - Proceedings 1998:21–29. Koslicki, David, and Hooman Zabeti. Improving MinHash via the containment index with applications to metagenomic analysis. Applied Mathematics and Computation 354 (2019): 206-215. Ondov BD, Treangen TJ, Melsted P, Mallonee AB, Bergman NH, Koren S, Phillippy AM. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol. 2016 Jun 20;17(1):132. MinHash Mash Containment MinHash Zhao X. BinDash, software for fast genome distance estimation on a typical personal laptop. Bioinformatics. 2019 Feb 15;35(4):671-673. BinDash Ertl, O.: New cardinality estimation algorithms for hyperloglog sketches. CoRR abs/1702.01284 (2017). 1702.01284 HLL card. estimation Dashing Baker DN, Langmead B. Dashing: fast and accurate genomic distances with HyperLogLog. In press, Genome Biology. Preprint: http://bit.ly/dash_pre