Upgrade to Pro — share decks privately, control downloads, hide ads and more …

Should you sequence your genome?

Should you sequence your genome?

Public talk at Pint of Science, Hull 2016

96e8ca061c005a42d360459d366ec923?s=128

Dave Lunt

May 23, 2016
Tweet

Transcript

  1. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG DrDaveLunt @davelunt Shouldyousequence yourgenome? Why? How? Cost? Privacy? davelunt.net
  2. nucleus chromosomes Whatisagenome? AgenomeisalltheDNAinacell

  3. nucleus chromosomes Chromosomes, biggest to smallest

  4. None
  5. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG your genome? should you sequence Its now quite cheap and easy
  6. December 2012 the Prime Minister announced that the Government intended

    to achieve a paradigm shift in the way that genomics is used across the NHS 100,000 Genome Project will position the NHS as world leaders in realising a new era of personalised medicine 100,000 genomes by end 2017 Rare diseases Cancer
  7. Do you have a rare disease?

  8. Jessica’s story SLC2A1 gene Glut1 deficiency Sugar transport to brain

    Ketogenic diet
  9. Compare the genome of your cancerous cells to genome of

    your normal cells What has changed to cause cancer? Sequencing your cancer From genome to treatment decisions
  10. “If I’ve learned anything, I’ve learned that ‘knowledge is power’

    – the more knowledge available to the oncologists the better the patient’s chance of recovery.” Andrew Anderson, cancer patient “cheaper for the NHS”
  11. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG my genome, my data, my health 23andme.com What does my genome sequence say about me?
  12. My ancestry

  13. My trait data

  14. My health data

  15. My Alzheimer’s risk is lower

  16. “find people 4 or 5 decades before they show the

    first symptoms, lowering their cholesterol, making sure they live an active physical and mental lifestyle …if you do that, you've decreased the incidence by 50% and you’ve prevented 10 million people from getting Alzheimer’s disease.” Dietrich Stephan
  17. We are all different in looks, body, behaviour and biochemistry!

    OR6A2 gene, scent/taste receptor Coriander tastes of soap for some people
  18. We are all different in looks, body, behaviour and biochemistry!

    People differ in the dose of medicines they require pharmacogenomics
  19. This anticoagulant would be inefficient for me “Physicians spend months

    and hundreds of thousands of dollars trying to find the right statin, the right blood thinner, or the right antidepressant for their patients, to say nothing of the right dose” Precision medicine
  20. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG Question: what are the pros & cons of nationwide medical genomics? Why? How? Cost? Privacy? Which patients? Insurance? Family?
  21. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG HIVtests Invitrofertilisation Hearttransplants Bloodtransfusions Smallpoxvaccines
  22. AGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACG ATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGAT CGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG CTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGA GCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCG ATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAG CTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACA TCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATC TGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCT AGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGG

    ACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAAC TGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAG CATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATAC GACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCA TCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTACGATCGATCGATCGA TGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTA GCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCATCGAGCGATCGACTA ACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGATCGATGCATGCTAC GATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGATCG ATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGGACATCGAGCGGCAT CGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGCATCTGAGCGATCGA TCGATGCATGCTACGATCGATCGATCGATGCTAGCTAGCTAGCATCGATGCTAGCTAGCTAGCTAGC TAGCTGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGGCGG ACATCGAGCGGCATCGAGCGATCGACTAACGATCGACTAGCATCAGACGATCGAACTGACGACTAGC ATCTGAGCGATCGATCGATGCTAGCTAGCTAGCAAGCTAGCATACGACATCGACGACGGACTATCGG Should patients drive this faster? Genomics will be integral to NHS care soon Any cause for concern? When should GP have genomes for all?